ID: 972794370

View in Genome Browser
Species Human (GRCh38)
Location 4:42400547-42400569
Sequence CAGTCTAAGCAAAGGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972794370_972794379 20 Left 972794370 4:42400547-42400569 CCTGGCTCCCTTTGCTTAGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 972794379 4:42400590-42400612 GGATTGCCAGCCTAAGAGAGGGG No data
972794370_972794377 18 Left 972794370 4:42400547-42400569 CCTGGCTCCCTTTGCTTAGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 972794377 4:42400588-42400610 ATGGATTGCCAGCCTAAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 76
972794370_972794374 -8 Left 972794370 4:42400547-42400569 CCTGGCTCCCTTTGCTTAGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 972794374 4:42400562-42400584 TTAGACTGGAGATTATTGAATGG 0: 1
1: 0
2: 4
3: 24
4: 256
972794370_972794375 -7 Left 972794370 4:42400547-42400569 CCTGGCTCCCTTTGCTTAGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 972794375 4:42400563-42400585 TAGACTGGAGATTATTGAATGGG 0: 1
1: 0
2: 3
3: 9
4: 162
972794370_972794376 -1 Left 972794370 4:42400547-42400569 CCTGGCTCCCTTTGCTTAGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 972794376 4:42400569-42400591 GGAGATTATTGAATGGGAGATGG 0: 1
1: 0
2: 1
3: 17
4: 274
972794370_972794378 19 Left 972794370 4:42400547-42400569 CCTGGCTCCCTTTGCTTAGACTG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 972794378 4:42400589-42400611 TGGATTGCCAGCCTAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972794370 Original CRISPR CAGTCTAAGCAAAGGGAGCC AGG (reversed) Intronic
900471688 1:2858138-2858160 GGGTGTGAGCAAAGGGAGCCTGG - Intergenic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
903466131 1:23553939-23553961 CAGACTTGTCAAAGGGAGCCTGG - Intergenic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
906794836 1:48688597-48688619 CAGTGTAAGCAAAGGGAACGAGG - Intronic
906847221 1:49206247-49206269 CAGTCTCAGTTAAGGGAGCTAGG - Intronic
908887193 1:68802972-68802994 CAGTCAAAGCAAAGGCAAACTGG + Intergenic
912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG + Intergenic
912710919 1:111949196-111949218 CACTCACAGCAAAGTGAGCCTGG + Intronic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
916455224 1:164964203-164964225 CAGTCCAAGCAAAAGCAGTCAGG + Intergenic
916950988 1:169780158-169780180 CATTCTAAACAAAGGAAGTCTGG - Intronic
920707215 1:208261802-208261824 CAGTCAAAGCAAAGGTGGACTGG - Intergenic
922852983 1:228749853-228749875 CAGAGTAAGCAAAGGAACCCAGG - Intergenic
1063352699 10:5371509-5371531 GACCCTTAGCAAAGGGAGCCTGG - Intronic
1063417112 10:5882678-5882700 CAGTATAAGAACAGAGAGCCAGG + Intronic
1066571970 10:36783576-36783598 CAGGCTAAGCGTAGGGTGCCAGG + Intergenic
1067547572 10:47205416-47205438 CAGTCTAAGCATAAGTGGCCAGG + Intergenic
1073322015 10:102621250-102621272 CAGTCCAAGCAAAGGTCTCCAGG - Intronic
1073515960 10:104075774-104075796 CAGCATAAGCAAAGACAGCCAGG - Intronic
1074234721 10:111573690-111573712 AGATCTAAGCAAAAGGAGCCTGG - Intergenic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1077630406 11:3807838-3807860 TGGTCTTTGCAAAGGGAGCCAGG + Intronic
1079074201 11:17373522-17373544 CAGTCTGAGCCACTGGAGCCAGG - Exonic
1080508228 11:32939908-32939930 CAGACTAGGAAAAGGGACCCTGG - Intronic
1081466683 11:43325752-43325774 CAGTCAAAGCAATGGCTGCCAGG + Intronic
1081943755 11:46969162-46969184 CTGTATTAGCAAAGTGAGCCAGG - Intronic
1082850693 11:57761820-57761842 CAGCCAAAGGCAAGGGAGCCTGG - Exonic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1084468768 11:69342982-69343004 AAGTCCAGGCAAAGCGAGCCAGG + Intronic
1084613107 11:70216739-70216761 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1087823343 11:102736414-102736436 CATTCTAGGCAAAAGAAGCCAGG - Intergenic
1087956858 11:104299239-104299261 CAGTCTCAGCAAAGGAACACAGG - Intergenic
1088993091 11:114971485-114971507 CAGACTGAACAAAAGGAGCCAGG - Intergenic
1089400440 11:118161249-118161271 CGGTCAAAGAAAAGGGAGCAAGG - Intergenic
1090271648 11:125390055-125390077 CTGTCTAGGCAAAGAGAGCCCGG - Intronic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1093224015 12:16459444-16459466 CAGGCTAACCAAAGGGAGAAAGG - Intronic
1093595178 12:20950756-20950778 CAGTTTGAGCAACTGGAGCCAGG + Intergenic
1094525409 12:31227756-31227778 CAGCCCATGGAAAGGGAGCCAGG + Intergenic
1094812718 12:34155047-34155069 CAGTCTCAGCAAAAGGTGACTGG - Intergenic
1097498174 12:60369501-60369523 CAGTCAAAGCAAAAGTAGACTGG - Intergenic
1097800264 12:63906155-63906177 CAGGCTAAGTGAAGGAAGCCAGG - Intronic
1102312471 12:111857268-111857290 TAGCCTAAGCAACGGGAGCGAGG - Intronic
1102387593 12:112523002-112523024 CAGTCAAAGCAAAAGCAGACCGG + Intergenic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1102946878 12:116997624-116997646 CAGTCCAAGCAGAGGCAGCAGGG + Intronic
1112228890 13:97568177-97568199 CAGTCTAGGAATCGGGAGCCTGG + Intergenic
1112371971 13:98802160-98802182 CAGACAAAGCAAAAGGAGACTGG - Intronic
1112557818 13:100485107-100485129 CAGTCTAAACAGAGGGGGACAGG + Intronic
1113242680 13:108355989-108356011 CAGTCAAAGCAAAAGCAGACAGG - Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1116534603 14:46014847-46014869 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1116621373 14:47208245-47208267 CAGCAAAAGCAAAGGTAGCCAGG + Intronic
1117080110 14:52143004-52143026 CAGGCAAAGCAAATGGGGCCAGG - Intergenic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1117692392 14:58321407-58321429 CAGATTTAGCCAAGGGAGCCTGG + Intronic
1118989669 14:70786368-70786390 ATCTCTAAGCACAGGGAGCCAGG + Intronic
1119025465 14:71148883-71148905 CTGTCTCAGAAAAGGGAGTCAGG + Intergenic
1119085922 14:71738838-71738860 CACTCTAAGCTCAGGGAGCAGGG - Intronic
1119667389 14:76494780-76494802 CAGTTAAAGCAGAGGAAGCCAGG + Intronic
1122439716 14:101722368-101722390 CAGTCTACGTAAAGCGAGCCTGG + Intergenic
1130329253 15:82908082-82908104 CTGTCCAAGCACAGGAAGCCAGG + Intronic
1130997015 15:88909556-88909578 CAGTCTCAGGAAAGAGGGCCAGG + Intronic
1131027119 15:89152658-89152680 AAACCTAAGCAAAGGGAACCTGG - Intronic
1134765757 16:16756105-16756127 TATTCTAAGCAAAAGAAGCCAGG - Intergenic
1134980296 16:18603114-18603136 TATTCTAAGCAAAAGAAGCCAGG + Intergenic
1136536545 16:30902970-30902992 CAGGCAAAGCAAAGAGAGGCTGG - Exonic
1137231269 16:46569674-46569696 CAGTCTCAACCAAGGAAGCCAGG - Intergenic
1137459084 16:48641846-48641868 CAGTCAAAACAAAAGCAGCCTGG + Intergenic
1138300667 16:55926848-55926870 CAGTCAAAGCAAAAGCAGACTGG - Intronic
1139543741 16:67638309-67638331 GACTCCAAGCAAAGGGAGTCAGG - Exonic
1142907361 17:3053133-3053155 CTCTCTAAGCAAAGGGAGGAGGG - Intergenic
1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG + Intergenic
1143086007 17:4416571-4416593 TAGTCTAAGGAAAGGGAGAGGGG + Intergenic
1146255233 17:31388490-31388512 CCCACTAAGCAAAGGGAGGCAGG + Intergenic
1147235861 17:39057045-39057067 CAGGCTCAGCGAAGGGAGGCTGG + Intergenic
1147893316 17:43732948-43732970 CAGTGCAAGCAAAGGAAGCGAGG + Intergenic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1149709161 17:58723395-58723417 CAGTCTGAGCAATGGGCACCTGG - Intronic
1151246090 17:72796083-72796105 CAGTCCTAGCAAATGGAGGCTGG - Intronic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1155666823 18:28319069-28319091 TAATGTAAGCAAAGGAAGCCAGG - Intergenic
1156714421 18:39989896-39989918 CATTTTAAGTAAAAGGAGCCAGG + Intergenic
1161961804 19:7527501-7527523 CAGTCTAAGGACAGGGAGTCAGG - Exonic
1163162477 19:15472879-15472901 AATTCTAAGCAAAACGAGCCTGG + Intronic
1163557731 19:18001992-18002014 CAGTCTAAGTTGAGGGAGTCTGG - Intronic
1164389579 19:27806086-27806108 CAGTCGCAGCCAAGGCAGCCTGG - Intergenic
1167141877 19:47657213-47657235 CATGCTGAGCAAAGGAAGCCTGG - Intronic
1167738141 19:51310174-51310196 CAGTGAAAGAACAGGGAGCCAGG + Intergenic
925319119 2:2948606-2948628 CAGGCTAGGCAAGGGGAGCAGGG + Intergenic
926513753 2:13815069-13815091 CAGTCTAATTAAAGAAAGCCAGG - Intergenic
928756414 2:34531090-34531112 CAGCCTAAAGAAAGGGAGCATGG + Intergenic
928855775 2:35801023-35801045 CAGTGTAAGAAAAGGCAGCAAGG - Intergenic
929233518 2:39584047-39584069 CAGCCTCAGTAAAAGGAGCCTGG + Intergenic
932033627 2:68216720-68216742 CATTCCAAGACAAGGGAGCCTGG + Intronic
932197335 2:69796045-69796067 CAGTCTGAGCCACTGGAGCCAGG + Intronic
933188204 2:79302314-79302336 CACTCCAAGCAAAAGGAGCAGGG - Intronic
935720120 2:105972611-105972633 CAGGTGCAGCAAAGGGAGCCAGG - Intergenic
935794654 2:106629374-106629396 CAGTATAAAAAAAGGGGGCCAGG - Intergenic
940087070 2:149872234-149872256 CAGCTTAAGCAAAGGGATCTGGG - Intergenic
944415720 2:199477785-199477807 CAGTCCTAGGAAAGGGAGACAGG + Intergenic
946153629 2:217792743-217792765 CAGTGTGGGCAAAGGGAGCCAGG - Intergenic
947032244 2:225809869-225809891 CAGTCAAAGCAAAAGCAGACCGG - Intergenic
947874957 2:233461760-233461782 CAGTGCAAGCAAAGGCAGCGGGG - Intronic
1168941707 20:1718350-1718372 CAGGCTCAGCAAAGGGAACTGGG + Intergenic
1171964132 20:31516593-31516615 CATTCTAAGCAAAAGAAACCAGG + Intronic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172173333 20:32957852-32957874 CAGTAGAAGCAAAGAGGGCCAGG - Intronic
1175353917 20:58346886-58346908 CAGTCTAATGAAAGGCAGACAGG - Intronic
1178582309 21:33847280-33847302 CAGTCTAGGCCAAGGCAGCCAGG - Intronic
1181615231 22:24049714-24049736 CAGTCTTAACAAAAGGAGCCTGG - Intronic
1183387842 22:37525310-37525332 CAGTCTCAGCGATGGGAGCCAGG - Intergenic
1183573970 22:38675217-38675239 CAGTGAGAGCAAAGGGAGCCTGG - Intergenic
950415938 3:12869116-12869138 CAGCCTGGGCAAAGAGAGCCCGG - Intronic
950417386 3:12876231-12876253 CAGCCTGGGCAAAGAGAGCCCGG - Intergenic
951221231 3:20070598-20070620 CAGTATAAGAAAAGAGAGGCCGG - Intronic
952284943 3:31959216-31959238 CAGTCTAATCAAATTTAGCCAGG + Intronic
954169107 3:48785876-48785898 CAGTCTAAGTAAAGGGCATCTGG + Intronic
955054422 3:55443270-55443292 CAGTTTAAGAAAAGGGACTCTGG - Intergenic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
959007113 3:101032396-101032418 CAGTCAAAGCAAAAGTAGACTGG + Intergenic
959937123 3:112040752-112040774 CAGTACAAGCAAAGGGAGACTGG + Intronic
960108722 3:113824862-113824884 CTGTGTAAGCAAAGGGTGACTGG + Intergenic
961181804 3:124883777-124883799 CTGTCTTAGCAAAGGCAGCGTGG + Intronic
962616778 3:137134585-137134607 CTGATTAAACAAAGGGAGCCGGG - Intergenic
963594751 3:147311865-147311887 TAGACAAAGCAAATGGAGCCTGG + Intergenic
964603009 3:158523964-158523986 CAGTCTAATCAAAAGCAGACTGG - Intronic
965484135 3:169257923-169257945 CAGTGTAAGAAAAAGTAGCCGGG + Intronic
965625325 3:170678869-170678891 CAGTCTAAGGAAATGGTGACAGG + Intronic
965813212 3:172613064-172613086 CAGTCAAAGCACAAGCAGCCTGG - Intergenic
966126253 3:176580362-176580384 CAGCCTATGCAAAGGGACCATGG - Intergenic
967947341 3:194814548-194814570 CAGTTTATGTAAAGGGAGACTGG + Intergenic
970265626 4:14281108-14281130 CAGTCTAGGCTAGAGGAGCCAGG - Intergenic
971745879 4:30579807-30579829 AAGTCTAAACAAAGGGAGAAAGG + Intergenic
971893770 4:32562593-32562615 CATTTTAAGCAAAGGAAGTCAGG - Intergenic
971992200 4:33913562-33913584 TGCTCTAAGCAAAGGGAGTCAGG + Intergenic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
978571223 4:110140036-110140058 CAGTCCCAGCTAAGGCAGCCAGG - Intronic
979770259 4:124515663-124515685 CTGTCTAAGTAAAGGGCCCCCGG - Intergenic
980234802 4:130091016-130091038 CACACCACGCAAAGGGAGCCAGG - Intergenic
980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG + Intergenic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
981756980 4:148150887-148150909 TAGGCTAAGCAAAATGAGCCAGG + Intronic
982365422 4:154572605-154572627 GAGTCTAAGCTAAGGAATCCGGG - Intergenic
984250814 4:177332347-177332369 CAGCCCAAGCAAAGGTACCCTGG - Intronic
988316799 5:29641726-29641748 CAGTCAAAGCAAATGTAGACTGG - Intergenic
988662909 5:33293050-33293072 CAGGTTAAGAAAAGGGAGACAGG + Intergenic
988729460 5:33956408-33956430 CAGTCAAAGCAAAAGCAGACAGG + Intronic
989786737 5:45341586-45341608 CAGTCAAAGCAAAAGCAGACTGG + Intronic
992005508 5:72473563-72473585 CAGTCTAAACAAAGGCAACGAGG - Intronic
995012827 5:107276990-107277012 AAATCTAAGCAAAAGGAGCATGG + Intergenic
996388370 5:122933427-122933449 GAGTTTAAGGAAAGGGAGCTGGG - Intronic
996408137 5:123126993-123127015 CAGTCTAAGTTCTGGGAGCCAGG - Intronic
997527218 5:134561112-134561134 AAGTCTAAGCCAAGGGGCCCTGG - Intronic
997642225 5:135456724-135456746 CTGTCCTAGCCAAGGGAGCCAGG - Intergenic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
999517393 5:152314874-152314896 CAGCCAAAGCAAAAGGAGTCGGG + Intergenic
1001138589 5:169123775-169123797 CAGTCAGAGCAAAGGCAGACTGG + Intronic
1001335231 5:170791174-170791196 CATTCTGAGAACAGGGAGCCTGG + Intronic
1001383211 5:171317427-171317449 AAGTCTAGGCAGATGGAGCCAGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002195869 5:177501032-177501054 CAGCCCAAGGAATGGGAGCCTGG - Intergenic
1002719099 5:181247029-181247051 CTGGGTCAGCAAAGGGAGCCCGG + Intronic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1005257320 6:24016818-24016840 CACTCTAAGTAAAGGGAGAAGGG - Intergenic
1005880465 6:30054788-30054810 CAGTCTGAGCAACGGGCACCTGG + Intergenic
1005938395 6:30542475-30542497 CAGTTTATGCAAATGGAGCTTGG - Exonic
1006021918 6:31122367-31122389 GAGACTCAGGAAAGGGAGCCTGG - Intronic
1011124525 6:83993004-83993026 AAGTCTAAGGAAAGGTGGCCAGG - Intergenic
1011612740 6:89169109-89169131 TAGTCTTAACAAAGGCAGCCTGG + Intergenic
1012116912 6:95311603-95311625 CAGTCAAAGATAGGGGAGCCAGG - Intergenic
1012769261 6:103408021-103408043 CAGTCTCAGGAAAAGGAGACAGG - Intergenic
1013715588 6:112957063-112957085 CAGTCCCAGAAATGGGAGCCAGG - Intergenic
1014320853 6:119926334-119926356 CAGTTCAAGGACAGGGAGCCTGG - Intergenic
1017696008 6:157017042-157017064 CACACTAAGCAAAGGGAAACAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018135885 6:160778168-160778190 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1018478469 6:164166874-164166896 AAGCAAAAGCAAAGGGAGCCGGG - Intergenic
1024141501 7:46467293-46467315 CAGTCTGAGCCATTGGAGCCAGG + Intergenic
1024617709 7:51129596-51129618 CAGACTAAGCTCAGGAAGCCAGG - Intronic
1026053866 7:66968341-66968363 AAGTCTAAGCAAAGCAAGCCAGG + Intergenic
1027924470 7:84443819-84443841 CAGTCAAAGCAAAAGTAGACTGG - Intronic
1028205550 7:88012793-88012815 TAGTCTCAGCAAAGGGAGTGAGG - Intronic
1028325166 7:89514942-89514964 CAGTCACAGCAAAAGTAGCCTGG + Intergenic
1030799041 7:113826885-113826907 CACTCTAAGAAAAGGGAGCTCGG + Intergenic
1033243673 7:139701567-139701589 TAGTCTAAGCCAAGGGTGGCAGG + Intronic
1033314069 7:140283348-140283370 CAGTCCCAGCAAAGGGCACCTGG + Intergenic
1033538948 7:142338462-142338484 CTGATTAAGCAAAGGGAGCCAGG + Intergenic
1034860645 7:154592052-154592074 CTGCGAAAGCAAAGGGAGCCTGG - Intronic
1038155439 8:24985082-24985104 CAGTCTAGGAAAAGGGAACAGGG + Intergenic
1040436780 8:47398845-47398867 GAGCCAAAGCAAAGGGAGCATGG + Intronic
1041317818 8:56582538-56582560 CATTCTAAGGAAAGAGGGCCTGG + Intergenic
1045213717 8:100125791-100125813 CAGTCCATGCTGAGGGAGCCAGG + Intronic
1045895487 8:107211027-107211049 CAGTCAAAGCAAAAGCAGACTGG + Intergenic
1047006211 8:120622990-120623012 CACTTTAAGCCAAGGGAGCCAGG - Intronic
1048971382 8:139646932-139646954 CAGTGTTAGGACAGGGAGCCAGG - Intronic
1051879934 9:21829527-21829549 CAGTGTAGGGAAAAGGAGCCTGG - Intronic
1058847574 9:108976276-108976298 CATACTAAGCAAAAGAAGCCAGG - Intronic
1060602428 9:124887067-124887089 CAGTCTGAGGAAAGGGAGAGAGG + Intronic
1061948501 9:133922100-133922122 CAAACAAAGCAGAGGGAGCCGGG - Intronic
1185991227 X:4894869-4894891 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1191218567 X:57960308-57960330 AACTCTAAGCAAAGGGGGCCTGG + Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1197323664 X:125065158-125065180 CAGTCAAAGCAAAAGCAGACAGG + Intergenic
1197355916 X:125437384-125437406 CAGTTTAAGCCACTGGAGCCAGG + Intergenic