ID: 972797558

View in Genome Browser
Species Human (GRCh38)
Location 4:42437108-42437130
Sequence GAGCAGAAACAGATGGTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972797555_972797558 -9 Left 972797555 4:42437094-42437116 CCTTAGGCCAGGGAGAGCAGAAA 0: 1
1: 0
2: 1
3: 27
4: 336
Right 972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 265
972797550_972797558 12 Left 972797550 4:42437073-42437095 CCTTCAGTAGTTTTATAGATCCC 0: 1
1: 0
2: 0
3: 11
4: 111
Right 972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 265
972797554_972797558 -8 Left 972797554 4:42437093-42437115 CCCTTAGGCCAGGGAGAGCAGAA 0: 1
1: 0
2: 1
3: 17
4: 227
Right 972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 265
972797549_972797558 27 Left 972797549 4:42437058-42437080 CCTTAACTTCAATTTCCTTCAGT 0: 1
1: 0
2: 3
3: 30
4: 361
Right 972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972797558 Original CRISPR GAGCAGAAACAGATGGTGCT CGG Intronic
900737330 1:4307365-4307387 GGGCAGACACAGAAGGGGCTTGG - Intergenic
900958833 1:5906515-5906537 CAGCAGAGACTCATGGTGCTAGG + Intronic
902186048 1:14726242-14726264 GGGCACAGACAGCTGGTGCTTGG + Intronic
902692430 1:18118255-18118277 AAGGAGGAAGAGATGGTGCTGGG - Intronic
902919674 1:19658277-19658299 GAGCAGACGCAGACAGTGCTGGG - Intronic
903444017 1:23409168-23409190 GAGGAGAAACACATGGGCCTTGG + Intronic
904299425 1:29544493-29544515 GGGCAGAAACAGAGGCTGCAAGG - Intergenic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
904470140 1:30730867-30730889 GAGTAGAAAAAAAAGGTGCTTGG + Intergenic
904484295 1:30814661-30814683 GGGGAGACTCAGATGGTGCTGGG - Intergenic
905448705 1:38044167-38044189 GAGAAGAAACATTTTGTGCTTGG - Exonic
906748146 1:48235854-48235876 GAGCAGGAGCTGATGGTGGTGGG + Exonic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
909050735 1:70764992-70765014 GAGCAGAAAGTGTTGGTGCCTGG + Intergenic
910682912 1:89885721-89885743 GAGAATAAACACATTGTGCTTGG + Intronic
911185775 1:94903369-94903391 GAGCAGAAACAGATTCTGGAGGG + Intronic
913100458 1:115559348-115559370 GAGAAGAAAGAGATGGAGATTGG - Intergenic
913110474 1:115653243-115653265 GATGAGAAACAGAAGGAGCTCGG + Intronic
913110684 1:115654686-115654708 GATGAGAAACAGAAGGAGCTCGG - Intronic
914912678 1:151800180-151800202 AAGCAGAAAGAGAAGGAGCTGGG + Intergenic
916014706 1:160739588-160739610 GAGCTGAAAGAAGTGGTGCTGGG + Intronic
917220645 1:172725103-172725125 GACATGACACAGATGGTGCTAGG - Intergenic
919059212 1:192609220-192609242 CAGTAGCAGCAGATGGTGCTTGG - Intergenic
919501048 1:198338647-198338669 TAACAGTAACAGATGGTGGTTGG + Intergenic
919820966 1:201471734-201471756 GAGCAGATAAAGATGGGGGTGGG + Intergenic
919939337 1:202275665-202275687 GACAAGGAACAGGTGGTGCTAGG + Intronic
920389369 1:205589357-205589379 GAGCAGAAAAAGATGAGGATGGG + Intronic
921777642 1:219120780-219120802 AATCAGAAACAGATGGTGCAAGG - Intergenic
922331670 1:224582334-224582356 GTGCAGAGACAGATGTGGCTGGG + Intronic
923087909 1:230715133-230715155 GAGCAGGAAGAGATGGTGCCTGG + Intergenic
924200251 1:241651060-241651082 GAGGAGAAACAAATGGGGTTGGG + Intronic
1063140309 10:3250902-3250924 GAGCACACAGAGATGGAGCTGGG + Intergenic
1063924726 10:10966578-10966600 TAGCTGATAAAGATGGTGCTTGG + Intergenic
1064235178 10:13567322-13567344 GAGCTGAAAGAGATGGTGGAAGG - Intergenic
1066441804 10:35446714-35446736 GAGCAGAGACTGACAGTGCTGGG + Intronic
1066450583 10:35524859-35524881 GAGTTGAAACAGATGCTGGTGGG + Intronic
1067719772 10:48719616-48719638 GAGGAGAAACAGGAGGGGCTGGG + Intronic
1069579843 10:69558633-69558655 GAGCACAAACCTATGGAGCTGGG - Intergenic
1069833530 10:71295021-71295043 GAGCAGGAACAGAAAGTGCATGG - Intronic
1071365065 10:84891125-84891147 GAGCAGCCACAGATGGCTCTGGG - Intergenic
1072158172 10:92742835-92742857 GAGTAGACATAGATGTTGCTGGG + Intergenic
1072408034 10:95173039-95173061 GAGCACAGACAGATGGGGCCTGG - Intergenic
1073033709 10:100548350-100548372 GGGCAGAGAGAGAAGGTGCTGGG - Exonic
1073087723 10:100905032-100905054 TAGCAGAAACATCTGTTGCTGGG - Intergenic
1073469908 10:103716097-103716119 GGGCAGAGGCAGATGCTGCTTGG - Intronic
1074254070 10:111782893-111782915 GAGCAGAAACTGAAGTTGCATGG + Intergenic
1074473079 10:113744784-113744806 GAGCAGCAAGAAATGGTGGTGGG - Intergenic
1074867272 10:117552306-117552328 GAGCAGAGCCAGAGGGAGCTTGG - Intergenic
1075159681 10:120012191-120012213 GAGCAGTGACAGATGCTGCCAGG - Intergenic
1075385785 10:122054356-122054378 GAGCAGAAAGAGATGCTACTGGG - Intronic
1077052744 11:575144-575166 GAGCAGCGACAGATGGAGGTCGG - Intergenic
1077103572 11:832627-832649 GAGGAGAAAGAGATGGGGGTTGG + Intergenic
1077903633 11:6511566-6511588 GAGCAGAAACTGCTGTTGCTGGG - Intronic
1079253088 11:18802023-18802045 GAGCAGCAACAGAAGCTGCCTGG + Intergenic
1079496845 11:21053587-21053609 TAGAAGTAGCAGATGGTGCTAGG + Intronic
1079883040 11:25950584-25950606 AAGTAGAAACACATGGTGTTGGG - Intergenic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1080060618 11:27952687-27952709 GAGCAGAAACATATGCTGGGAGG + Intergenic
1080736245 11:35017161-35017183 AAGCAGTAACAGAAGGCGCTCGG + Intronic
1082005198 11:47415293-47415315 GAGCAGAAGCAGCTGCTGCAGGG - Exonic
1083052399 11:59788979-59789001 GAGCTGAGATAGATGGTGGTGGG - Intronic
1084161050 11:67350440-67350462 AAAAAGAAACTGATGGTGCTGGG - Intronic
1084458123 11:69280294-69280316 GACAAGAAATAGATGATGCTGGG - Intergenic
1085761427 11:79244501-79244523 GTGCAGAACCAGGTGGTGATAGG + Intronic
1086858044 11:91890353-91890375 GAGCAGATATAGGTGGTTCTGGG - Intergenic
1088772607 11:113050124-113050146 GGGCAGAAACAGAGGGTGGGGGG + Intronic
1088923585 11:114279653-114279675 GAGCAGAAGGAGACAGTGCTAGG + Intronic
1090543849 11:127739730-127739752 CAGCAGAAAAAGATGGGGCCAGG + Intergenic
1093306707 12:17529043-17529065 AAGCAGGAACAGATGGGGTTGGG + Intergenic
1096501183 12:52064624-52064646 GAGTAGAAACTGAGGGTTCTGGG - Intergenic
1096629446 12:52916429-52916451 TAGCTGGAACAGAAGGTGCTAGG - Intronic
1097133015 12:56827499-56827521 CAGGAGAACCACATGGTGCTGGG + Intergenic
1098062130 12:66574099-66574121 GTGCAGAAACAAATGGTTGTAGG + Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1101404112 12:104412974-104412996 GACCAGAAACAGGAGGTGTTAGG + Intergenic
1103379043 12:120479631-120479653 CTGAAGAACCAGATGGTGCTAGG + Intronic
1103950150 12:124546019-124546041 GAGCAGAAACAGCCTGTGCCTGG - Intronic
1104661528 12:130614431-130614453 GAGCAGTAACAGACAGCGCTGGG + Intronic
1105213714 13:18272603-18272625 GATCAGAAACAGGTGGCGCCTGG - Intergenic
1105973684 13:25454381-25454403 GAGCAGACAGAGATGGAGTTAGG + Intronic
1107769313 13:43773077-43773099 GTGCAGGAATAGATGGTGGTGGG - Intronic
1107903681 13:45043048-45043070 GAGCAGATAAAGATGGTTATGGG + Intergenic
1108734379 13:53267293-53267315 GAGCAAAAACATGTGGTGTTTGG + Intergenic
1109874251 13:68378664-68378686 GATCAGAAACAGAATCTGCTTGG - Intergenic
1110168687 13:72474300-72474322 GAACTAAAACAGCTGGTGCTAGG + Intergenic
1110185720 13:72672749-72672771 CATCAGAAACAGAGCGTGCTGGG - Intergenic
1111977272 13:94979612-94979634 GAGCAAAAACAGAAGGTGTAAGG + Intergenic
1113857073 13:113452906-113452928 TATTAGAAACAGAAGGTGCTAGG + Intronic
1114171289 14:20274470-20274492 GAGCAGGAACAGAGAGTGGTGGG + Intronic
1115147414 14:30241410-30241432 GAGCATACACAGATGGGGTTAGG - Intergenic
1115879200 14:37895816-37895838 GAACAGAGACAAATGTTGCTTGG - Intronic
1117164852 14:53023019-53023041 GAGCTGAGGCAGCTGGTGCTTGG + Intergenic
1117562752 14:56959331-56959353 GTGAAGACACAGATGGTGATGGG + Intergenic
1118648753 14:67867745-67867767 GTCCAGAAACAGCTGGGGCTGGG - Intronic
1119539982 14:75431653-75431675 GAACAGAAACAAAGGGTGCCAGG - Intronic
1119647871 14:76361430-76361452 GAGCAGAAAAAGCTAGTGTTTGG + Intronic
1119951794 14:78752764-78752786 GACCAGAGAGAGATGGTGCTTGG + Intronic
1120790545 14:88577088-88577110 GATCAAAAACTGATGGTGCCAGG - Intronic
1120968842 14:90191004-90191026 GAGCAAAATTAGATGATGCTTGG - Intergenic
1121349218 14:93160356-93160378 TTGTAGAAACAGGTGGTGCTGGG - Intergenic
1121755191 14:96396400-96396422 CAGCAAAAAGAGATGGGGCTGGG - Intronic
1126878774 15:53072226-53072248 GAGAAGAGACAGCTGGTGCAGGG + Intergenic
1127956767 15:63860552-63860574 GAGCAGAACCAGATCATCCTTGG + Intergenic
1128288287 15:66456802-66456824 TAGCAGAAACAGTTGATGCTGGG + Intronic
1129962943 15:79704940-79704962 AAGCAAAAACAGAAGCTGCTTGG - Intergenic
1130760949 15:86819121-86819143 GAGCAGAAAAAGAAAGTGATGGG + Intronic
1130929678 15:88414718-88414740 GAGCAAAAACAGATGATACAAGG + Intergenic
1131667742 15:94588158-94588180 GGGCAGAACCGGATGGGGCTGGG + Intergenic
1132689626 16:1176748-1176770 GCCCAGAAAATGATGGTGCTGGG + Intronic
1136037494 16:27550999-27551021 GAGGACAATCAGCTGGTGCTTGG - Intronic
1136281764 16:29217675-29217697 GAGGAGAGACAGGTGGTGGTTGG + Intergenic
1137724412 16:50647352-50647374 GAGCACACACAGAGAGTGCTGGG + Intergenic
1137802613 16:51275164-51275186 GAGCAGAGCCAGCTAGTGCTAGG + Intergenic
1139846082 16:69922555-69922577 GAGCAGAAAAGGATGGAGATGGG - Intronic
1141788287 16:86216246-86216268 GATCAGCAAGAGGTGGTGCTGGG + Intergenic
1141898000 16:86970951-86970973 CAGCAGAGCCATATGGTGCTGGG - Intergenic
1142086143 16:88183591-88183613 GAGGAGAGACAGGTGGTGGTTGG + Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143385262 17:6525484-6525506 GAGCAGAAGCAGGTGCAGCTAGG + Intronic
1144733366 17:17541318-17541340 GAGCTGAAAGAGCTGGGGCTCGG - Intronic
1144754316 17:17669925-17669947 GACCAGGAGCAGATGGGGCTTGG - Intergenic
1148159720 17:45443032-45443054 GTGCAGAAACAGGTGGTGGTGGG + Intronic
1149000619 17:51753631-51753653 GAGAATAAGCAAATGGTGCTGGG - Intronic
1149935441 17:60801669-60801691 GAGAAGAAACAGATTGTTATAGG - Intronic
1150198360 17:63325506-63325528 GAGAGGAAACATAGGGTGCTAGG - Intronic
1150261782 17:63798959-63798981 GATTAGAAACAGATGGTTGTGGG + Intronic
1150391006 17:64789904-64789926 GTGCAGAAGCAGGTGGTGGTGGG + Intergenic
1150409788 17:64933958-64933980 GTGCAGAAGCAGGTGGTGGTGGG + Intergenic
1151023436 17:70647259-70647281 GAACAGACACAGATGGGGATTGG - Intergenic
1151040453 17:70854033-70854055 GAGGAAAAAAAGATGGTCCTGGG - Intergenic
1154423328 18:14253043-14253065 GAGGAAAAGCAGATGGCGCTGGG + Intergenic
1158250197 18:55479441-55479463 GGGCAGAAAGAGATGGGGATTGG - Intronic
1159272501 18:66170464-66170486 GTGCAGAAACAAATGGATCTTGG - Intergenic
1161515456 19:4693788-4693810 GAGAAAAAGCAGATGGTGCAGGG - Intronic
1162244209 19:9385745-9385767 GTGTAGCAACAGCTGGTGCTGGG + Intergenic
1162549365 19:11350048-11350070 AAGGAGAAACAGAGGTTGCTGGG - Intronic
1163018827 19:14472210-14472232 GAGCAGAGACAGAGGGTGTGTGG - Intergenic
1163349059 19:16763924-16763946 GAGCTGAAACAGGAGGTTCTGGG + Exonic
1164843647 19:31413416-31413438 GAGCACAAACAGATGCGTCTCGG - Intergenic
1167526178 19:49985265-49985287 TAGCTTTAACAGATGGTGCTGGG - Intronic
1167687748 19:50967292-50967314 GAGCAGAATAAGTTGGTGCATGG - Exonic
1167689064 19:50974758-50974780 GCCCAGAAACAGAAGGGGCTGGG + Intergenic
925075963 2:1015850-1015872 CAGCAGATACAGATGATGCTGGG - Intronic
925121551 2:1422207-1422229 GAGCAGGAAGAAATGATGCTGGG + Intronic
925148130 2:1594648-1594670 GAGCAGAATGAGAAGGGGCTGGG - Intergenic
926171670 2:10556552-10556574 GAGCAGGGAGAGATGGGGCTGGG + Intergenic
926943372 2:18161718-18161740 GAAGAGAAAGAGATGGTGCATGG - Intronic
927564955 2:24104120-24104142 GAGCCCAAACAGCTGGTGCCTGG - Intronic
928334481 2:30384668-30384690 GAGCAGGAATAGATGCTGATAGG + Intergenic
929777587 2:44938593-44938615 GAGCAGAAGCAGAGGGACCTTGG - Intergenic
932192344 2:69751545-69751567 GAGCAGAAAAAGACAGGGCTGGG + Intronic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
936118997 2:109725395-109725417 GGGGAGAAACCCATGGTGCTTGG + Intergenic
939069603 2:137523308-137523330 GAGAAGAAACAGAGGTTTCTGGG - Intronic
939443398 2:142277596-142277618 GAGAAGAAAGAGATGGAGATGGG - Intergenic
941041590 2:160629291-160629313 AAGCAGCAAGAGAAGGTGCTAGG - Intergenic
941301406 2:163807232-163807254 GAGTAGAAAAAAATGTTGCTAGG + Intergenic
944338466 2:198566020-198566042 CCCCAGAAACAGATGCTGCTAGG + Intronic
945045875 2:205781374-205781396 GAGCAGAAACAGACCGGCCTAGG - Intronic
945909902 2:215636487-215636509 GAGCAGAAACTGAGCATGCTTGG + Intergenic
946414783 2:219534528-219534550 CAGCAGAAACAGAAGGTGAGAGG - Intronic
947007291 2:225526891-225526913 TGGCAGAATCAGATGCTGCTAGG + Intronic
948127475 2:235575163-235575185 GAGAATAAAGAGATGGTGGTTGG + Intronic
948251330 2:236532242-236532264 GAGCAGCCACAGCCGGTGCTGGG - Intergenic
1176039289 20:63055957-63055979 GAGCAGGAGCAGCTGGAGCTTGG + Intergenic
1177748069 21:25245448-25245470 GAACTGATACAGATGGTGATAGG - Intergenic
1178630877 21:34260408-34260430 GACTAGAAACAGAAGGTGCAAGG - Intergenic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1180701445 22:17783563-17783585 GAGGAGGAAAGGATGGTGCTAGG + Intergenic
1181609584 22:24003719-24003741 AAGCAGAGACAGATGGTGCAAGG + Intergenic
1182438030 22:30343278-30343300 GAGCAGAAATAGAGGGAGGTGGG - Intronic
1183338053 22:37262215-37262237 CAGCAGCAGCAGATGGTGGTGGG + Intergenic
1183739842 22:39663416-39663438 GGGCAGAAGCAGAGGGTACTAGG + Intronic
1185144475 22:49123569-49123591 GAGCAGATACAGAGGGTGAACGG - Intergenic
1203266646 22_KI270734v1_random:18705-18727 GGTCAGAAACAGGTGGTGCCTGG - Intergenic
950289074 3:11769029-11769051 GAGCAGAGACAGAGGGTGGAGGG + Intergenic
951162083 3:19436298-19436320 GAGCAGAAACAGGCTGTCCTAGG + Intronic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
953187104 3:40648267-40648289 GTGTAAAACCAGATGGTGCTTGG + Intergenic
953223082 3:40991384-40991406 GAGCAGTGACTGATGGTGCTTGG + Intergenic
954303699 3:49714539-49714561 AAGCAGAAGGACATGGTGCTGGG - Intronic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
954801090 3:53187278-53187300 GAGGAGAAGCAGAGGCTGCTCGG + Intronic
956156793 3:66306739-66306761 GAGCAAGAACATATGGTGTTTGG + Intronic
957424779 3:80023560-80023582 CAGCAGAAGCTGTTGGTGCTAGG + Intergenic
960650828 3:119947522-119947544 GAGCAGTAACAGATAGTTCATGG - Intronic
961346720 3:126268050-126268072 GAGCAGAAACACACGGTGAAGGG - Intergenic
963521148 3:146361227-146361249 GAGCAGGAACAGTTGGGACTTGG - Intergenic
964016933 3:151959223-151959245 GAACAGAAAGAGATAGTGCCTGG - Intergenic
964590152 3:158352748-158352770 GACCACAATCAGTTGGTGCTGGG + Intronic
966899711 3:184471852-184471874 GAACAGAAACATATGGGGCAGGG - Intronic
968561370 4:1284813-1284835 GCCCAGAGACGGATGGTGCTGGG - Intergenic
972330511 4:38059958-38059980 GAGCAAAAACATGTGGTGTTTGG + Intronic
972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG + Intronic
972873724 4:43331661-43331683 GAGCAGCAAAGGATGCTGCTTGG - Intergenic
972958476 4:44421775-44421797 CATCAGAAACAGATGTTGCATGG - Intronic
973288546 4:48446497-48446519 GGGCTGAAAAAGCTGGTGCTGGG - Intergenic
976144597 4:82029972-82029994 AGGCAGAAACTGATGGAGCTAGG - Intronic
977049640 4:92113133-92113155 GAGCAGAAGCAGAGGGTACACGG - Intergenic
977475292 4:97499786-97499808 CAGCAGAAACAGCTAGTGCAAGG + Intronic
977681948 4:99806932-99806954 GAGCACACACAGATGGTCCAAGG + Intergenic
978105364 4:104895679-104895701 GAACAGGAAGAGATGGTGCCAGG - Intergenic
983694449 4:170510976-170510998 AAGCCGTAACAGATGGTGCCTGG - Intergenic
985706945 5:1406823-1406845 GACAAAAAGCAGATGGTGCTGGG - Intronic
987729733 5:21753534-21753556 GAACAGAAAGGTATGGTGCTTGG - Intronic
988563732 5:32303602-32303624 GAGAATAAACTCATGGTGCTAGG + Intronic
990223612 5:53624100-53624122 AAGCACCAACAAATGGTGCTGGG - Intronic
990237240 5:53781392-53781414 GAACAGAAACAGGTGGGGCAAGG - Intergenic
992944714 5:81798739-81798761 GAGCAGCAAAAGATGTTGCTGGG + Intergenic
994784339 5:104136863-104136885 GGCAAGAAACAGATGGTGCATGG - Intergenic
995775251 5:115718107-115718129 CAGCAGAGTCAGATGTTGCTTGG + Intergenic
996718500 5:126607357-126607379 GAGAAGAAACAAAGGGTGCCAGG + Intronic
996731947 5:126725221-126725243 GAGCAGAAGGAATTGGTGCTAGG - Intergenic
997596762 5:135112226-135112248 GAGCAGAGACAGATGTGGCTGGG + Intronic
998553560 5:143101375-143101397 GAGCAGAAATAGAAGGTGTATGG - Intronic
998624180 5:143826580-143826602 GAGCAGCTACAGATGGGGCCAGG - Intergenic
999061026 5:148635380-148635402 GAGGAGAAACATATGTTGATGGG + Intronic
999236822 5:150103603-150103625 AAGCACAATCAGATGGCGCTGGG + Intronic
1000420381 5:161031920-161031942 TAGCAGAGACAGATGGTGGAGGG - Intergenic
1000510118 5:162170627-162170649 GAGCAAGAACATATGGTGTTTGG - Intergenic
1001208721 5:169790066-169790088 GAGGAGAATCAGATGATGATTGG + Intronic
1002607186 5:180390358-180390380 GAGGAGAAACAGAAGAAGCTCGG - Intergenic
1004880634 6:20003904-20003926 CAGCAGTAACAGATGGTTCTCGG - Intergenic
1006255954 6:32832471-32832493 GAGAAGAAAGAGATGAGGCTGGG + Intronic
1006856482 6:37137288-37137310 GAACAGAAACAGATCCTGCCAGG + Intergenic
1006856492 6:37137337-37137359 AAGCAGAAACTGATTGTGCCCGG + Intergenic
1013059184 6:106615196-106615218 GGGAAGAAACAGGTGGTGGTGGG + Intronic
1014018743 6:116564796-116564818 GAATAGAAAGAGATGGTGCCTGG + Intergenic
1018662978 6:166105432-166105454 GAGCAGACACAGGTGGAGGTAGG + Intergenic
1018858403 6:167692106-167692128 GATCAGAAACAGAGGGGGGTGGG + Intergenic
1019790189 7:3007010-3007032 CAGCAGAAAAAGGTGGTGGTGGG + Intronic
1020097191 7:5375803-5375825 GAGCAGAGGCAGATGGAGATTGG - Intronic
1020814917 7:12893506-12893528 GAGGAGTAGCAGATGGTGATGGG - Intergenic
1022582888 7:31574475-31574497 GACCAGAAAAAAATGGTGTTGGG + Intronic
1023102916 7:36737172-36737194 GAGAAGACACAGAGGGTCCTTGG + Intergenic
1023815736 7:43948546-43948568 AAGCAGAAGCAGCTGCTGCTGGG - Intronic
1023980764 7:45068737-45068759 GAGCAGAGAGAGGTGGGGCTGGG - Intronic
1026646268 7:72172012-72172034 CAGCAGATAGAGATGCTGCTGGG - Intronic
1027252141 7:76405698-76405720 GAGGTGAAAAAGATGCTGCTTGG + Intronic
1029304299 7:99607434-99607456 GGGCAGATGCAGAGGGTGCTAGG + Intronic
1029680244 7:102103304-102103326 GACAAGAAACATGTGGTGCTAGG - Intronic
1031339830 7:120585488-120585510 GCAGAGAAACATATGGTGCTTGG + Intronic
1031714040 7:125085044-125085066 GAACAGGAAGAGATGGTGCCTGG - Intergenic
1033538570 7:142334815-142334837 GAGCAGAAACAGATGGACAGTGG - Intergenic
1033723556 7:144087174-144087196 TAGCAGAAGCAGATGATTCTCGG - Intergenic
1034058121 7:148058317-148058339 TGGCATAAACAGATGCTGCTGGG - Intronic
1034852107 7:154503078-154503100 GAGCAGAAACAGAGGAAGCAAGG - Intronic
1037678433 8:21072730-21072752 GAGCAGCCACTGATGGTGCCTGG - Intergenic
1037683294 8:21116755-21116777 GAGCAGAAGCAGGTGGTGAGTGG - Intergenic
1038342920 8:26703063-26703085 GAGTGGAAACAGATGTTTCTGGG + Intergenic
1038453191 8:27652972-27652994 TAGCAGACACAGGTGGTGATGGG - Intronic
1039085754 8:33777968-33777990 GAGAAGCAACATATGCTGCTGGG - Intergenic
1040879312 8:52188376-52188398 CAGCAGAAACAGCAGGTGCAAGG + Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044361963 8:91296135-91296157 CATCAGTAACAAATGGTGCTTGG + Intronic
1045109692 8:98928668-98928690 GAGAAGAAAAGAATGGTGCTTGG - Intronic
1047386234 8:124412039-124412061 AAACAAAAACAAATGGTGCTGGG + Intergenic
1048289485 8:133169662-133169684 AATGAGAAACACATGGTGCTGGG + Intergenic
1048327972 8:133453269-133453291 GTGCAGAAGCAGATGGGCCTTGG + Intergenic
1048618778 8:136108863-136108885 TATCAGAAACAGAGGGTGGTGGG - Intergenic
1052024680 9:23561389-23561411 AAGAAGAAAGAGATGCTGCTGGG - Intergenic
1053283863 9:36838297-36838319 GAGCAGTGAGAGATGGTTCTGGG - Exonic
1055094472 9:72397535-72397557 GAGCAGATGAAGATGATGCTTGG - Intergenic
1055886734 9:81071814-81071836 GAGCAGAACCAGGTGTTTCTTGG - Intergenic
1057187291 9:93063874-93063896 GAGCAGAGAAGGATGGTGCCTGG - Intronic
1061817033 9:133203738-133203760 GAGCAGAAATGGATGATGGTTGG + Intergenic
1189518188 X:41737110-41737132 GAGCAAAAATGGAAGGTGCTAGG - Intronic
1190013456 X:46805528-46805550 GAGCAGAAACGGAAGCTGCAAGG - Intergenic
1190215832 X:48478871-48478893 CAGCAGAAAATGATGATGCTGGG + Intronic
1190290235 X:48987719-48987741 GACCAGAAGCAGATGGAGATGGG + Intronic
1190756976 X:53409649-53409671 AAGCAGACATAGATGGTGTTCGG + Intronic
1192555212 X:72083872-72083894 GAGTAGAGACAGATCGTGCAGGG - Intergenic
1194429376 X:93782223-93782245 GGGCAGAAAATGATGGGGCTGGG + Intergenic
1196777712 X:119355563-119355585 GTGCTGAAAAAAATGGTGCTGGG + Intergenic
1196902699 X:120401507-120401529 GAGCAGAAGCAGCTGCTGGTTGG + Intergenic
1198114645 X:133533463-133533485 CAGCAGAAACACAGGGTGCCTGG + Intergenic
1199692465 X:150319096-150319118 GAGCACTAACAGAAGATGCTAGG + Intergenic
1199977919 X:152905223-152905245 CAGCAGAAACAGATGCTGAGAGG - Intergenic
1200254023 X:154569697-154569719 GAGGAGAAAATGATGGTGCTCGG - Intergenic
1200263746 X:154634711-154634733 GAGGAGAAAATGATGGTGCTCGG + Intergenic
1200281728 X:154782481-154782503 GAGCAGAAAGAGATGGCCCCAGG - Intronic
1200943908 Y:8812651-8812673 AAGTAGAAACAGATTGTACTAGG - Intergenic