ID: 972801801

View in Genome Browser
Species Human (GRCh38)
Location 4:42483545-42483567
Sequence CCTTCTAGGGACCTGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972801795_972801801 4 Left 972801795 4:42483518-42483540 CCGCACGTGCACGGCAGGGTGTG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 972801801 4:42483545-42483567 CCTTCTAGGGACCTGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972801801 Original CRISPR CCTTCTAGGGACCTGGTGCC TGG Intronic
No off target data available for this crispr