ID: 972804568

View in Genome Browser
Species Human (GRCh38)
Location 4:42515306-42515328
Sequence GCAGCTACTAAGAATAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972804568 Original CRISPR GCAGCTACTAAGAATAGATG TGG Intronic
901060316 1:6468835-6468857 GCAGCTACCACGAATGGATCAGG + Intronic
902587954 1:17452740-17452762 GCAGCTAAAAATAATACATGAGG + Intergenic
908050729 1:60227045-60227067 GCAGCTACTGAGGAAAGAAGGGG + Intergenic
908933345 1:69342826-69342848 GATTATACTAAGAATAGATGTGG - Intergenic
911600939 1:99847834-99847856 CCAGCTACTGGGAATGGATGAGG + Intergenic
918270416 1:182893068-182893090 GCAGCTACTCAGAAAAGCTAAGG + Intergenic
918994727 1:191742535-191742557 GCAGCTTTTAAGAAGAAATGTGG + Intergenic
924369761 1:243335233-243335255 TGAGCTTCCAAGAATAGATGGGG + Intronic
1063914487 10:10867692-10867714 GCAGGTTTAAAGAATAGATGAGG - Intergenic
1065553558 10:26892327-26892349 TGAGCTTCTAAGAAGAGATGAGG + Intergenic
1065599604 10:27355294-27355316 TGAGCTTCTAAGAAGAGATGAGG - Intergenic
1066092585 10:32039948-32039970 GCTGCTGTTAATAATAGATGTGG - Intronic
1073129877 10:101181192-101181214 GCAGCTTCTACGGCTAGATGTGG + Intergenic
1074263246 10:111875122-111875144 GCAACTACTGAGGAGAGATGGGG - Intergenic
1074835774 10:117291592-117291614 GCAGCTACTAAGGAGGGCTGAGG + Intronic
1075196010 10:120359628-120359650 GTAGCTACGAAGAATAAATGTGG - Intergenic
1078660440 11:13281366-13281388 GCAGGTACTAAGAATGGAGCAGG - Intronic
1087799276 11:102486582-102486604 GAGGCTACTAAGACTAAATGAGG + Intronic
1088527026 11:110767765-110767787 GCAGCTAAAAAGAAAAGCTGAGG - Intergenic
1089038423 11:115421449-115421471 GCAGCTACTGTGAAAAGGTGTGG - Intronic
1090131100 11:124142760-124142782 GAAGCTAGTAGGAATTGATGGGG + Intronic
1090601707 11:128379137-128379159 GAAGCAACTAAGATTAAATGAGG - Intergenic
1093387416 12:18575194-18575216 GCAGTTACTAAGAAAACAAGTGG + Intronic
1095583726 12:43828661-43828683 GCAGGGACTCAGAATAGAGGAGG - Intergenic
1098926383 12:76354755-76354777 GAAGTTACTAAGAAGAGAGGAGG + Exonic
1101329073 12:103742769-103742791 GCAGCCACTAAGGCAAGATGTGG + Intronic
1102807294 12:115793205-115793227 GCAGCTAATGAGAAGAGATTTGG + Intergenic
1102968125 12:117144443-117144465 GCAGTTACTAGAAAGAGATGGGG - Intronic
1109171641 13:59105349-59105371 GCAGGTATTAAGAAGAGAAGTGG - Intergenic
1109371825 13:61431838-61431860 GCAGCTAGTAAAAATACATTTGG + Intergenic
1110734200 13:78915988-78916010 GCACCTACCATGAATAGATCTGG - Intergenic
1112463823 13:99625838-99625860 GCAGCTCCTAAGAAGAGAGAAGG + Intronic
1119849277 14:77855304-77855326 GCTGCTACGAAGATTACATGGGG - Intronic
1120232181 14:81851738-81851760 GCCTCTACGAACAATAGATGTGG - Intergenic
1121989373 14:98540530-98540552 GCAGCTATTAATCAAAGATGAGG - Intergenic
1138077074 16:54053129-54053151 ACAGTTATTAAGAATAGAAGTGG - Intronic
1138233290 16:55356717-55356739 CCAGCTACTGAGAATAGCTGAGG + Intergenic
1140527166 16:75632502-75632524 GAAACTACTAACAAAAGATGTGG + Intronic
1140952193 16:79829294-79829316 GCAGCTACTAATATTTTATGAGG - Intergenic
1141186086 16:81788607-81788629 GCAGCCACGCAGCATAGATGAGG - Intronic
1141321912 16:83018913-83018935 GCACTTACTACGAATAGAGGTGG + Intronic
1143807738 17:9443210-9443232 GCAACTCCTAAGAATAGTGGTGG - Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153318284 18:3745987-3746009 GCAGCTATAAAGTATAGCTGAGG - Intronic
1157645271 18:49262714-49262736 CCAGCCAGTAAGAATGGATGTGG - Intronic
1162786603 19:13038917-13038939 GCAGCTAATAAGCGTGGATGGGG + Intronic
925113495 2:1355758-1355780 GCAGCTACTATGAATAGTATGGG - Intronic
927800209 2:26091868-26091890 ACAGCTAGTAAGATCAGATGAGG + Intronic
929042374 2:37758024-37758046 GCAGCTTCTCAGAAGTGATGTGG + Intergenic
931763421 2:65435434-65435456 GCAGCTCCATAGAATAAATGAGG + Intergenic
932838966 2:75063948-75063970 GCAGCTTCTCAGAAGAGATCAGG + Intronic
933045276 2:77527849-77527871 ACAGCTTCTAAGAAGACATGTGG + Intronic
938203945 2:129401368-129401390 GCAGCTCCTAAAATTACATGAGG + Intergenic
938209096 2:129450455-129450477 TCAAATACTAAGAATAGAAGGGG + Intergenic
939313524 2:140516497-140516519 GCAGATACCAATAATAGGTGGGG + Intronic
939550396 2:143608060-143608082 GCAGCTGCTAAGAAGGGAGGGGG - Intronic
939589057 2:144041568-144041590 GCTAATAGTAAGAATAGATGTGG - Intronic
939738340 2:145877499-145877521 GGAGCTTTTAAGAATAGATTAGG + Intergenic
942086677 2:172450275-172450297 GCAGTTGCAAAGAACAGATGTGG + Intronic
942811915 2:180009731-180009753 GGAGCAAGTAAGAATATATGTGG - Intergenic
943781785 2:191831812-191831834 GCAGCTACTGACAATGGATGAGG + Intergenic
944116585 2:196193563-196193585 GCAGTTAATAAAAAGAGATGGGG - Intergenic
1169824423 20:9751418-9751440 GCTGCTAATCAGAAGAGATGAGG - Intronic
1171853003 20:30321813-30321835 GCAGGCACTAAGAAGATATGTGG + Intergenic
1176695690 21:9974773-9974795 GAAGCTTCTTAGAATTGATGGGG + Intergenic
1182554128 22:31119864-31119886 GCAGGTACAAAGCATGGATGGGG - Exonic
1183410253 22:37650709-37650731 GCAGCTACCAAGGAAAGGTGAGG + Exonic
1183699584 22:39443544-39443566 GGAGCTAATGAGAAAAGATGCGG + Intergenic
1203294566 22_KI270736v1_random:29515-29537 GCAGCTCCTCAGAAGTGATGTGG + Intergenic
950135257 3:10576491-10576513 TCAGCTACTAAGAAGACAGGTGG - Intronic
950504291 3:13384482-13384504 CCAGCTACTCAGAAGAAATGAGG + Intronic
951527965 3:23671871-23671893 GCAGCTTCTATTAATAAATGGGG - Intergenic
951621165 3:24603487-24603509 GCTGCTACTAAGGAAAGCTGAGG - Intergenic
955421766 3:58745376-58745398 GCAGCTACTAAAGATTAATGAGG + Intronic
956609476 3:71107791-71107813 TGAGCTACTAAGATTATATGCGG + Intronic
957363452 3:79189457-79189479 GCTGCTCCTAAGAAAAGGTGAGG + Intronic
958134887 3:89476319-89476341 GCAGCTATGAAGAAGTGATGAGG + Intronic
958528858 3:95297855-95297877 GGACCTACTCAGAATAGATAAGG - Intergenic
959988607 3:112605356-112605378 GCAGCTGCTAAAACTACATGTGG - Exonic
960294540 3:115927204-115927226 CCAGCCACAAAGAATAGATAGGG + Intronic
962893186 3:139691008-139691030 TCAGCTACTTAGAAGATATGTGG - Intergenic
967597566 3:191345161-191345183 GCATCTTCTAAGAATAGACAAGG + Intronic
967685490 3:192411103-192411125 GAAGCTACTGAAAATGGATGTGG + Intronic
972804568 4:42515306-42515328 GCAGCTACTAAGAATAGATGTGG + Intronic
979609479 4:122674062-122674084 GCAGGGAATAAGAAGAGATGGGG - Intergenic
979787226 4:124731530-124731552 GCAGGTAGAAAGAATAGTTGGGG - Intergenic
980368311 4:131835006-131835028 GAAGCTTCTTAGAATTGATGGGG + Intergenic
982470767 4:155787249-155787271 GCAGCCACTAAGTATTGAAGAGG - Intronic
984088272 4:175339220-175339242 GTGGCCACTAAGAATAGATGAGG - Intergenic
988648188 5:33119465-33119487 GCAGCTAATAAATATAGATTTGG + Intergenic
989164390 5:38420511-38420533 GCAGCTACTATTTCTAGATGGGG - Intronic
989785875 5:45328863-45328885 GCATCTACTTTGCATAGATGTGG + Intronic
992788459 5:80192177-80192199 GCTACTAGGAAGAATAGATGAGG + Intronic
993726793 5:91378325-91378347 GAAGCTACTAAGACTTGATAGGG + Intronic
995016300 5:107313451-107313473 GCAGATCCTAACAAGAGATGCGG + Intergenic
995390690 5:111637591-111637613 CTAGCTTCTCAGAATAGATGTGG + Intergenic
996292285 5:121866331-121866353 GCAGCTATTTACAAAAGATGGGG - Intergenic
996658116 5:125966248-125966270 GAAGATACTAAGAACAGCTGGGG + Intergenic
1000487169 5:161861583-161861605 TCAGCTACTAAGTCTAGATATGG - Intronic
1003413204 6:5884259-5884281 GCAGCCACAAAGAAGAGAAGAGG - Intergenic
1008054662 6:46933959-46933981 GAAGAAACTAAAAATAGATGTGG - Intronic
1011655827 6:89551219-89551241 GCAGCTACTGACGATAGGTGGGG - Intronic
1015041877 6:128730901-128730923 GCAGCTATTAAAAATAGCTTAGG + Intergenic
1015410438 6:132887915-132887937 GCAGTGGCTAAGAAGAGATGGGG + Intergenic
1019396033 7:818487-818509 GCAGCTACTATGAACATTTGTGG + Intronic
1020491022 7:8784496-8784518 GCAGGTACTAAGAAAAGTTGGGG - Intergenic
1024801186 7:53081663-53081685 CAAGCTACTATGAATATATGCGG - Intergenic
1030744215 7:113145651-113145673 GCTGCTACACAGAAGAGATGAGG + Intergenic
1031741748 7:125441343-125441365 GCAGCTACTGAGACAAGAAGGGG + Intergenic
1038207622 8:25482267-25482289 TCAAATACTAAGAATAGGTGTGG + Intronic
1038501916 8:28052011-28052033 CCAGGTAGTAAGAAAAGATGTGG + Intronic
1038567592 8:28632852-28632874 GTTGCTATTAAGAATAAATGTGG - Intronic
1038611169 8:29061371-29061393 GCAACTACTAGGAAAAGAGGAGG - Intronic
1038721843 8:30044089-30044111 GGAGGTAATAAGATTAGATGAGG - Intergenic
1041235560 8:55798097-55798119 ACAGCTACTAAGCATTGCTGAGG + Intronic
1042121650 8:65495020-65495042 CCAGCTAATAAAAATAAATGTGG - Intergenic
1052040645 9:23735214-23735236 GTAGCTTCTGAGAATAGCTGAGG - Intronic
1053773084 9:41502803-41502825 GAAGCTTCTTAGAATTGATGGGG - Intergenic
1054313766 9:63558878-63558900 GAAGCTTCTTAGAATTGATGGGG + Intergenic
1059777770 9:117492936-117492958 GCAGCTACAATGAAGAGATCAGG + Intergenic
1189910838 X:45809383-45809405 GCAGCTCCTATGACTAGATTTGG - Intergenic
1200874841 Y:8142862-8142884 GCAGCTACTATGGAGAAATGTGG - Intergenic
1200987158 Y:9314221-9314243 GCAGCTACTATGGAGAAATGTGG + Intergenic
1201016769 Y:9611889-9611911 GCAGCTACTATGGAGAAATGTGG + Intergenic
1201058841 Y:10023804-10023826 GCAGCTACTATGGAGAAATGTGG + Intergenic
1202118428 Y:21498419-21498441 GCAGCTACTATGGAGAAATGTGG - Intergenic
1202120880 Y:21521959-21521981 GCAGCTACTATGGAGAAATGTGG - Intronic
1202123331 Y:21545500-21545522 GCAGCTACTATGGAGAAATGTGG - Intronic
1202155677 Y:21883881-21883903 GCAGCTACTATGGAGAAATGTGG + Intronic
1202158125 Y:21907422-21907444 GCAGCTACTATGGAGAAATGTGG + Intronic
1202171751 Y:22054604-22054626 ACAGCTATTAAGAGTAGTTGTGG + Intergenic
1202184576 Y:22172347-22172369 GCAGCTACTATGGAGAAATGTGG + Intronic
1202206784 Y:22414054-22414076 GCAGCTACTATGGAGAAATGTGG - Intronic
1202219611 Y:22531768-22531790 ACAGCTATTAAGAGTAGTTGTGG - Intergenic
1202240627 Y:22764172-22764194 GCAGCTACTATGGAGAAATGGGG + Intergenic
1202323566 Y:23664315-23664337 ACAGCTATTAAGAGTAGTTGTGG + Intergenic
1202393613 Y:24397925-24397947 GCAGCTACTATGGAGAAATGGGG + Intergenic
1202477172 Y:25272175-25272197 GCAGCTACTATGGAGAAATGGGG - Intergenic
1202547205 Y:26005739-26005761 ACAGCTATTAAGAGTAGTTGTGG - Intergenic