ID: 972805171

View in Genome Browser
Species Human (GRCh38)
Location 4:42522594-42522616
Sequence ATTTTGTCCTGGGGAAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972805171_972805175 -5 Left 972805171 4:42522594-42522616 CCAATTTTTCCCCAGGACAAAAT 0: 1
1: 0
2: 0
3: 27
4: 305
Right 972805175 4:42522612-42522634 AAAATTTAAGCCCCAAAGCACGG 0: 1
1: 0
2: 5
3: 27
4: 263
972805171_972805179 15 Left 972805171 4:42522594-42522616 CCAATTTTTCCCCAGGACAAAAT 0: 1
1: 0
2: 0
3: 27
4: 305
Right 972805179 4:42522632-42522654 CGGCTTATACATGTTTCATCAGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972805171 Original CRISPR ATTTTGTCCTGGGGAAAAAT TGG (reversed) Intronic
901232831 1:7650737-7650759 ATTTTGTCCTCAGGACCAATAGG + Intronic
902743334 1:18455766-18455788 ATTTTGTTTTGGGTAAAGATGGG + Intergenic
902855006 1:19195754-19195776 ATTTTGGTGTGGGGAAATATTGG - Intronic
904895380 1:33813594-33813616 ATAATGTCCAGAGGAAAAATGGG - Intronic
905520625 1:38596816-38596838 ATTTTGTCCTGGACACACATTGG - Intergenic
906320980 1:44815251-44815273 ATTTTGTCCTGGAGGTCAATGGG - Intronic
907168739 1:52440520-52440542 ATGTTGTCCTGGCAAAAACTAGG - Intronic
907904876 1:58775428-58775450 ATGTTATCCTGGAGAAAAATGGG - Intergenic
908137664 1:61149995-61150017 ATTTTCTCCAGAGGAAAAAAAGG - Intronic
908451642 1:64261925-64261947 ATTTTATCCTGAAGGAAAATGGG - Intronic
909733429 1:78925552-78925574 ATTTTCTCAGGGGAAAAAATGGG + Intronic
910784169 1:90976166-90976188 ATTTTGACCTTGGGAAAATATGG - Intronic
912793745 1:112676931-112676953 TTTTAGTACTGGGGAAAAACTGG + Intronic
915358939 1:155273899-155273921 CTTTTGTCCTGGGGATAGGTAGG - Intronic
915774124 1:158464117-158464139 ATTTTGTCTTGGGAAATTATTGG - Intergenic
915975012 1:160379675-160379697 GTTTTATCCTGGGGAAATAATGG - Intergenic
916570122 1:166017836-166017858 AGTTTCTCCTGGAGTAAAATGGG - Intergenic
916973047 1:170044711-170044733 AGTCAGTCCTGGGGAAAAAGAGG - Intronic
917117551 1:171617705-171617727 GTTTTGTGGTGGGGAAAAGTGGG + Intergenic
917876646 1:179292630-179292652 TTTTTGTCCTGGGGAGGAGTGGG + Intergenic
919579744 1:199356735-199356757 ATTATAGCCTGGGGAAAATTTGG - Intergenic
921741641 1:218691925-218691947 ATTTTCTCCAGGGGAATAAAAGG - Intergenic
922110117 1:222548043-222548065 ATTTTGGCCTTGGGAACACTCGG + Exonic
922426847 1:225505182-225505204 ATCTTTTATTGGGGAAAAATTGG - Intronic
923271180 1:232356511-232356533 ATTTTATCCATAGGAAAAATGGG - Intergenic
924031780 1:239892795-239892817 ATTATGTCCTTGGCTAAAATAGG - Intronic
924402614 1:243703035-243703057 TTTTTGTCTTAGGTAAAAATTGG - Intronic
1062823940 10:555336-555358 ATGTTGTCCTTATGAAAAATTGG - Intronic
1063092806 10:2882703-2882725 ATTTTGCTCTTGAGAAAAATGGG + Intergenic
1063282181 10:4642367-4642389 ATTTTGTCCTGGAGAAGACAAGG + Intergenic
1063537862 10:6902656-6902678 ATTTGGTTCTGGGTAAAGATGGG + Intergenic
1063974100 10:11401663-11401685 CTTTTGTTTTGGGGAAAAATGGG + Intergenic
1064330517 10:14389810-14389832 GCTTTGTCCTGGGGAAGAATTGG - Intronic
1064965680 10:21013059-21013081 ATTTTATCCAGGGGTACAATGGG + Intronic
1065564571 10:26995861-26995883 ACTGAGTCCTGGGGAAAAATTGG + Intronic
1065732660 10:28723463-28723485 ATTTTGTATGGGGGAAAAAATGG - Intergenic
1065784319 10:29199378-29199400 ATTATGTCCTTGGCAAAACTTGG - Intergenic
1067136013 10:43607583-43607605 CTTTTATCCTGGAGAAAACTAGG + Intronic
1068001459 10:51338892-51338914 AGTTTGTCCTGGAGAATAATTGG + Intronic
1068008275 10:51416250-51416272 ATTTTATCATGGTGAAAATTAGG + Intronic
1069249597 10:66251575-66251597 ATTTGGTCTTGTGGAAATATTGG - Intronic
1071664983 10:87545947-87545969 ATCATGTCGTGGGGCAAAATTGG + Intronic
1072113493 10:92346325-92346347 ATTTTGTGCTGGGGCTAAAATGG - Intronic
1073890466 10:108095831-108095853 ATTGTGTGCTGAGTAAAAATGGG - Intergenic
1074304692 10:112265899-112265921 CTTTTGTCCTGGGCACAAAGTGG - Intergenic
1074437276 10:113444897-113444919 ATTTTGTCCAGCTGAAAAACAGG + Intergenic
1074749277 10:116568318-116568340 ATTCTGTCCTGGGGACCACTGGG - Intergenic
1075506900 10:123031900-123031922 GTTGTGTCCGTGGGAAAAATAGG + Intronic
1075807723 10:125202178-125202200 ATTCTGTCCTGGGGCTAAGTGGG - Intergenic
1075909984 10:126116089-126116111 ATTTTGACTTGTGGAGAAATGGG - Intronic
1077808248 11:5610813-5610835 ATCTTGTCCTGGCTAAAAACCGG + Exonic
1078042427 11:7880389-7880411 AATGTGTCCGTGGGAAAAATTGG + Intergenic
1078244058 11:9557161-9557183 GTGTTGTCCTGGAGAAGAATTGG - Intergenic
1078655256 11:13232805-13232827 AATTTGTCCTAAGGAACAATGGG + Intergenic
1078761526 11:14255659-14255681 ATTTTCTCCTGGGGAATGGTGGG - Exonic
1079712285 11:23700585-23700607 TTTTTTTCCTGGGTAAAAATAGG - Intergenic
1080223673 11:29935521-29935543 ATTATATCCTGGGAAATAATAGG - Intergenic
1081093777 11:38906032-38906054 TATTTGTCTTGGGGAAACATTGG - Intergenic
1081531303 11:43961362-43961384 ATCTTGTCCCCGGGAAAAATAGG - Intergenic
1081726748 11:45335252-45335274 TTTTTGTGCTAAGGAAAAATAGG + Intergenic
1082061503 11:47864740-47864762 ATTTCATCCTGGAGATAAATTGG - Intergenic
1082820315 11:57540512-57540534 ATTGTGTTCTGTGGAAAACTAGG - Intergenic
1082850562 11:57760825-57760847 ATTTTGATTTGGGGACAAATTGG + Intronic
1083503765 11:63136411-63136433 ATGTTGTCATGGAGAAGAATTGG - Intronic
1083870490 11:65484952-65484974 ATTTTGTATTTGGGAAAAGTTGG - Intergenic
1088158187 11:106834985-106835007 ATTTTATTCTGAGGAAAACTAGG - Intronic
1088212495 11:107472383-107472405 ATTTTTTGGTGGGGGAAAATAGG - Intergenic
1088320395 11:108549534-108549556 AATTTGTCCTGGAGAAAAGATGG - Intronic
1089431796 11:118431009-118431031 CTTTTTTTCTGGGGAAAAAAGGG - Intronic
1089595369 11:119575550-119575572 AATATGACCTGGGAAAAAATAGG + Intergenic
1089661269 11:119987251-119987273 ATTTTATGCTGGGCAAATATGGG - Intergenic
1090242245 11:125192404-125192426 ATTGTTTCCTGGGGAAAGCTGGG + Intronic
1091752673 12:3032533-3032555 ACTGTGTCCTGGGCAAATATTGG + Intronic
1092203125 12:6599604-6599626 CTTTTGTCCTGGGAAAATATAGG - Intronic
1095948294 12:47766411-47766433 ACTTGGGCCTGGGGACAAATGGG - Intronic
1097040390 12:56152858-56152880 CTTTTGTTCTGGGGTAAATTAGG - Intronic
1097224969 12:57471658-57471680 ATTTTGTAGTGGGGGCAAATAGG + Exonic
1097502086 12:60416785-60416807 ATTTTCTTCTGGGATAAAATTGG + Intergenic
1098070293 12:66667567-66667589 CTGTTATCCTGGGGAAAAAGTGG - Intronic
1098259273 12:68651460-68651482 AATATTTCCTAGGGAAAAATAGG - Intronic
1099287500 12:80732750-80732772 ATTTTGTAGTCAGGAAAAATTGG + Intergenic
1099885577 12:88526075-88526097 AGTTTGTGTTGGGGAATAATGGG + Intronic
1100022557 12:90088092-90088114 CTTTTGCCCTAGTGAAAAATTGG + Intergenic
1100692401 12:97052406-97052428 TTTTTGGCTTGGGGAAAAAAAGG - Intergenic
1101061949 12:100981605-100981627 ATTCTTTACTGGGGAAAAGTAGG + Intronic
1103092121 12:118104581-118104603 ATTCTGTCCTGGGGAAAATGCGG + Intronic
1105879992 13:24596267-24596289 GTTTTGTGATGGTGAAAAATTGG + Intergenic
1105919843 13:24952586-24952608 GTTTTGTGATGGTGAAAAATTGG - Intergenic
1106463378 13:29991766-29991788 ATTTTGTCATGGGTAAAATGGGG + Intergenic
1106765734 13:32911902-32911924 TTTTTGTAATGGTGAAAAATTGG - Intergenic
1106778968 13:33037114-33037136 ATTGTGTCTTGGGGAACATTGGG + Intronic
1107184610 13:37504331-37504353 ATTCTTTCCTGGGAAAAATTCGG - Intergenic
1107313517 13:39106004-39106026 AAGTTCTCCTGGGGAAAACTTGG - Intergenic
1108335916 13:49442312-49442334 ATTTTGTTCTTGTGAAAAATTGG - Intronic
1108452932 13:50585563-50585585 AAATTATCCTGGGAAAAAATGGG - Intronic
1110270742 13:73587206-73587228 ATTTTGATTTGGGGAAATATGGG - Intergenic
1110545809 13:76754108-76754130 GTTTTGTCGTGGAGAATAATTGG - Intergenic
1111533098 13:89565722-89565744 ATTATGTCTAGAGGAAAAATTGG + Intergenic
1111876480 13:93903594-93903616 CATTTGTCCTGTGGAAGAATAGG - Intronic
1113141724 13:107159692-107159714 ATTTTGTCATGTGCAAAGATGGG - Intergenic
1113524370 13:110963006-110963028 AATTTGTCTTTGGTAAAAATGGG + Intergenic
1114255592 14:20999018-20999040 ATTTTGTACTGGGGACAATCTGG - Intergenic
1114327782 14:21606646-21606668 TTTTTGTTCTGGAGAAAAATGGG + Intergenic
1114832810 14:26164872-26164894 TGTTTGTTCTGGAGAAAAATAGG - Intergenic
1115033453 14:28828402-28828424 TTTTTGTGCTGGAGAACAATAGG + Intergenic
1115555008 14:34538541-34538563 ATATTGTCATGGGGAGACATTGG - Intronic
1115658387 14:35465994-35466016 ATTTTGACATGGGGCAAATTGGG - Intergenic
1116203747 14:41834150-41834172 TTTTTTTCCTAGGGAAAAAGTGG - Intronic
1117865864 14:60148667-60148689 ACTTGGTCCTGGGGAGAAGTGGG + Intronic
1118030733 14:61815395-61815417 ATTTTGTGGGGGAGAAAAATGGG - Intergenic
1119625331 14:76169400-76169422 ATTTTGTTTGGGGGAAAAAAAGG - Intronic
1120206193 14:81589911-81589933 ATTCTGTGCTGGGGAAAATGAGG - Intergenic
1125560122 15:40624253-40624275 ATTTTGCACTGGGCAATAATTGG - Exonic
1126168759 15:45676402-45676424 ATTGTGTGCTGGGGAAGACTGGG + Intronic
1127840672 15:62828839-62828861 ATTTTGTGCTAGAGAAACATAGG + Intronic
1127939286 15:63677594-63677616 GTTTTGTTTTGGGGAAAAAATGG - Intronic
1128208719 15:65875997-65876019 ATTTTTTCCTTTGTAAAAATTGG - Intronic
1128721199 15:69949823-69949845 TTTTTCTCCTTGTGAAAAATGGG - Intergenic
1130849009 15:87775808-87775830 ATGTTGTCATGGAGAAGAATTGG - Intergenic
1130930099 15:88419814-88419836 ATTGTACCCTGGGGAAAAAAAGG + Intergenic
1131299524 15:91184457-91184479 GTTGTTTCTTGGGGAAAAATTGG + Intronic
1131574054 15:93568646-93568668 ATTTTGTCCTCAGAAAAACTGGG + Intergenic
1132158158 15:99511565-99511587 AATGTGTGCTGGGGAAATATTGG + Intergenic
1134017154 16:10896808-10896830 ACTGTGCTCTGGGGAAAAATTGG - Intronic
1137450337 16:48567941-48567963 ATTTAGTGCAGGGGAAATATTGG - Intronic
1140235470 16:73154694-73154716 AATATGTTCTGGGGAAAAAGTGG + Intergenic
1141418754 16:83898308-83898330 ATTTTGTCCTCTAGAAAGATAGG - Intergenic
1143134412 17:4703661-4703683 AGTTTCTCCAGGGGAAAAATGGG - Intronic
1145778998 17:27549807-27549829 ATCTTGTCCTCCAGAAAAATGGG - Intronic
1146098009 17:29951248-29951270 TTTCTGTCCAGGAGAAAAATTGG - Intronic
1146736593 17:35243526-35243548 GTTGTGGCCTGGGGACAAATAGG + Intronic
1149467768 17:56893270-56893292 ATTTTGCCTTGGGGGAAACTCGG - Intronic
1149856158 17:60084883-60084905 AGTATGCCCTGGAGAAAAATTGG - Intergenic
1150025615 17:61671085-61671107 ATTTTGTCCGGGGTGATAATGGG + Intergenic
1153054683 18:934346-934368 AATTTTTCCTGGTGAAAAGTGGG + Intergenic
1153060315 18:988197-988219 TTTTTGTCCTGGAGAACATTTGG + Intergenic
1153152999 18:2115612-2115634 ATGTTTCCCTGGAGAAAAATTGG - Intergenic
1153666682 18:7372569-7372591 CTTTTTTCCTGGGGAAAGAGGGG - Intergenic
1154949860 18:21199234-21199256 ATTTTCCCCTGGGGTAAAATAGG - Intergenic
1155720881 18:29010375-29010397 ATTGTTTCCTAGGGAAAAGTTGG - Intergenic
1157058847 18:44262640-44262662 ATTTTTCCCTTGGGAACAATGGG + Intergenic
1158360252 18:56664765-56664787 ATTTTATCCTTGAGAAACATAGG + Intronic
1160435357 18:78847944-78847966 AATCTGACCTGGGGAAAATTTGG + Intergenic
1166476706 19:43132924-43132946 AAGATGTCCTGGGGAAAAACTGG + Intronic
1167850534 19:52197933-52197955 ATTCTGTCATGGTGAAAAAAGGG + Intronic
1168635992 19:57997519-57997541 ATTTTTTCCTGTGGGAAACTCGG - Intronic
925640704 2:5983638-5983660 ATTTAGCCCTGGGGACAAAATGG + Intergenic
925780282 2:7375644-7375666 ATTTTGTCCAGTGGAAATACTGG - Intergenic
926758605 2:16256382-16256404 GTGTTGTCATGGGGAAGAATTGG - Intergenic
927023726 2:19043976-19043998 TTATTGTCATGGGGAGAAATGGG - Intergenic
927139352 2:20119095-20119117 AGTCTGTCCTGTGGAAATATGGG - Intergenic
927974053 2:27324537-27324559 ATTTTTTACTGGAGAAAACTGGG + Intronic
928521550 2:32094083-32094105 ATTATGTGCTGGTTAAAAATTGG - Intronic
928577312 2:32668400-32668422 ATTATCTCCTGGTGATAAATAGG + Intronic
929895137 2:45953263-45953285 ATTTTGTCTTGGGGAAGATGAGG + Intronic
930258261 2:49116215-49116237 ACTTTGTCCTGGAGGAAAATAGG + Intronic
933117126 2:78488213-78488235 ATTATCTCCTAGGGAAAAAATGG - Intergenic
933764818 2:85699537-85699559 ACTGTGTCCTGGAGAATAATGGG + Intergenic
933859050 2:86446111-86446133 ATTTTCTGTTGGGGAAACATTGG + Intronic
934959321 2:98654946-98654968 ATTGTGTTCTTGGTAAAAATTGG + Intronic
936548952 2:113418214-113418236 AATTTGTCTTGGAGAAAACTCGG + Intergenic
937620207 2:123976648-123976670 TTTTTGTCCTGGAGAAACAAAGG + Intergenic
938164725 2:129016705-129016727 AGCTTGTTCTGGGGGAAAATAGG + Intergenic
939520844 2:143228568-143228590 TTTTTGTCCTAAGGAAAAACTGG + Exonic
941098457 2:161269331-161269353 TTTGTGTCCTACGGAAAAATAGG + Intergenic
941275886 2:163490201-163490223 ATTTTATTTTGGGGAAAAAATGG - Intergenic
941345978 2:164370193-164370215 ATTTTTTTCTGCAGAAAAATTGG - Intergenic
942703743 2:178744765-178744787 GTATTGGCCTGGGGAAAAAAGGG - Intronic
943296936 2:186152821-186152843 GTTTTATCCAGGGGAAAAATAGG + Intergenic
943795161 2:191983400-191983422 TTTTTCTCCTGGGGCAAAAAGGG + Intronic
944769261 2:202897218-202897240 TTTTGGTGCTGGGGAAGAATGGG - Intronic
946093328 2:217249871-217249893 AGTCTGCCCTGGGGACAAATTGG + Intergenic
1168958641 20:1852935-1852957 ATTTTGGCCTGGTGCAGAATGGG - Intergenic
1169390188 20:5184350-5184372 ATACAGTCCTGGGGAAAGATAGG + Intronic
1169569224 20:6888355-6888377 ATTATGTCCTTGGGAAAACAGGG + Intergenic
1169962258 20:11174438-11174460 AGTTTGTCCTGAAGACAAATAGG - Intergenic
1173008934 20:39163639-39163661 ATTTTGTCCTTGGAAACCATGGG + Intergenic
1173928575 20:46799371-46799393 TGTCTGTCCTGGGGGAAAATTGG + Intergenic
1176729154 21:10473320-10473342 ATTATGTCCTGAGGAACAGTTGG + Intergenic
1176905317 21:14493373-14493395 CTATTGTCCTTGGGGAAAATGGG - Intronic
1177437619 21:21076785-21076807 CTTTTGTCTTGGAGCAAAATGGG + Intronic
1177587056 21:23110736-23110758 AATTTGTCCTTGAGAAAAGTAGG + Intergenic
1178186010 21:30221359-30221381 AGTTTCTACTGGGGAAATATTGG + Intergenic
1178794198 21:35728576-35728598 AATTTTTCCTGTGTAAAAATAGG + Intronic
1180032390 21:45221425-45221447 GTTTTATTCTGGGGAAAAAAGGG - Intronic
1181440169 22:22931655-22931677 GATTTGTGCTGGGGAGAAATAGG + Intergenic
1183874673 22:40769449-40769471 ATTTTGTCATAGGGACAAAAAGG + Intergenic
1185092647 22:48784742-48784764 ATTTTGTGCTGGGAAGATATGGG + Intronic
949361324 3:3235069-3235091 AATTTATCCTTGGGAGAAATGGG + Intergenic
950573140 3:13814456-13814478 ATTCTGTGCTGGAGACAAATAGG + Intergenic
950691129 3:14658859-14658881 TTTTTCTCCTAGGGAAAAATTGG + Exonic
952911694 3:38194595-38194617 AGTTAGTACTGGGGAAAGATGGG + Intronic
953060857 3:39427848-39427870 AATGTGTCCTAGGGGAAAATGGG + Intergenic
953071499 3:39525337-39525359 TTTCTGACTTGGGGAAAAATGGG + Intronic
953642318 3:44720468-44720490 AATTAGTACTGGGGAAAAGTTGG - Intronic
955155829 3:56415721-56415743 ATTTTCTCCTGGGGAAATGCTGG + Intronic
956188362 3:66584004-66584026 ATTTTGTCATTTGGAAAAAAGGG - Intergenic
958201917 3:90331238-90331260 ATTTTGACCTATGGAGAAATAGG - Intergenic
958630513 3:96676875-96676897 ATATTGTCCTAAGGAAAACTTGG + Intergenic
959338828 3:105101514-105101536 AATTAGTCTTGGGGAAAAAAAGG + Intergenic
959660176 3:108859591-108859613 ATTCTGTACTTAGGAAAAATGGG - Intergenic
959924394 3:111905228-111905250 ATTTTGTTCTGGGGATAGGTGGG + Intronic
962317180 3:134366206-134366228 CTTTTGTTCTAGAGAAAAATTGG - Intronic
963650054 3:147968129-147968151 ATTTTGTGCTGGGGAATTGTAGG + Intergenic
964196101 3:154066622-154066644 GCGTTGTCCTGGAGAAAAATTGG + Intergenic
965301077 3:167005530-167005552 ACTTTCTCATGAGGAAAAATGGG - Intergenic
966535288 3:181026426-181026448 ATTTTTTACTTGGGAAAAACTGG + Intergenic
966749929 3:183312512-183312534 ATTTTGTGCTTGGGAATTATGGG + Intronic
966817158 3:183898657-183898679 ATTCTGTCCTTGGCAGAAATTGG - Intergenic
969147853 4:5139710-5139732 TTTGTGTGCTGGGGAAAAAATGG + Intronic
970450418 4:16161122-16161144 ATTTTGTCTTTGGAAAAAATAGG - Exonic
972059037 4:34844910-34844932 ATTTTGTTGAGGGGAAAAAGTGG - Intergenic
972617901 4:40717866-40717888 ATTTTCTCATCGGCAAAAATGGG - Intergenic
972805171 4:42522594-42522616 ATTTTGTCCTGGGGAAAAATTGG - Intronic
973224791 4:47771128-47771150 ATTTTGCATTGGGAAAAAATGGG + Intronic
974652014 4:64766458-64766480 ATTCTGTCCTTGGGAGAAAATGG + Intergenic
975169676 4:71218880-71218902 ATTACTTCCTTGGGAAAAATAGG + Intronic
975511346 4:75196548-75196570 GTGTTGTCATGGGGAAGAATTGG + Intergenic
975678274 4:76849847-76849869 TTTTTCTCCTGGGAAAAAAATGG - Intergenic
975770693 4:77719125-77719147 ACTGTTTTCTGGGGAAAAATTGG - Exonic
975780630 4:77835895-77835917 ATTTTCTTCTGGGGAAAATCTGG - Intergenic
975818973 4:78250152-78250174 ATATTTTCTTGGGGAAAATTTGG + Intronic
975941348 4:79650730-79650752 AGTTTGTTCTGGGGAAAATCTGG + Intergenic
977263367 4:94824722-94824744 AATTGATCTTGGGGAAAAATGGG + Intronic
978162015 4:105559940-105559962 ATTTTATCATTGAGAAAAATAGG + Intronic
979544951 4:121929846-121929868 ATTTTTTCCTAGTGAAAAAGAGG - Intronic
979647744 4:123091721-123091743 ATTATGACCTAGGGAAAAAGTGG - Intronic
979844124 4:125486665-125486687 ATTTTGTCCAGGAGAACATTGGG - Intronic
980281466 4:130727604-130727626 AGTTTCCCCTTGGGAAAAATAGG + Intergenic
980573443 4:134653807-134653829 ATTTTGTATTTGGGAAATATTGG - Intergenic
981075816 4:140590521-140590543 GCATTGTCCTGGGGAAGAATTGG - Intergenic
981542131 4:145856534-145856556 ATCTGTTCCTGGGGAAAAAGAGG + Intronic
981656990 4:147123129-147123151 AATTTTTCCTGGGATAAAATGGG - Intergenic
982212193 4:153047083-153047105 ATTTTGTCTGGGGGAACAGTTGG - Intergenic
984746771 4:183228452-183228474 ATATTGGGGTGGGGAAAAATGGG + Intronic
985225686 4:187759450-187759472 ATTTTTTCCTAAGGAAAATTGGG - Intergenic
987493120 5:18606685-18606707 ATTTTGCCCTGGGGAGATAGTGG + Intergenic
988431389 5:31122908-31122930 TTTTTGTCTTGGGCAAAGATAGG + Intergenic
988904783 5:35775369-35775391 AGTTTTTCCAGGGGAAAAATTGG + Intronic
991485965 5:67137548-67137570 TTTTTGTCTTGGAAAAAAATGGG - Intronic
992996213 5:82336170-82336192 TTTTGGTACTGGGGAAAATTAGG - Intronic
994148400 5:96420563-96420585 ATTTCTTCCTTGGGGAAAATGGG - Intronic
994667238 5:102720213-102720235 ATATTGTCAAGGGGAAAAAAGGG - Intergenic
995342717 5:111077469-111077491 CTTTTGTCCTGAGGAAAATCAGG + Intronic
995997222 5:118316003-118316025 ACTTTGTCCTGTGGAAGACTTGG - Intergenic
996772372 5:127098714-127098736 AGTTTGTCAGGGAGAAAAATGGG - Intergenic
998010093 5:138688038-138688060 ATTTTGACTTGGTGTAAAATAGG + Intronic
998477558 5:142434419-142434441 TTTTTGTCTTGGGGACAATTGGG - Intergenic
1000670829 5:164061029-164061051 ATTGTGTAATGGGGAATAATTGG - Intergenic
1000968052 5:167682972-167682994 AGTTTTTCCTGGGGAAAGAAAGG - Intronic
1001247563 5:170116389-170116411 AATTTCTTCTGGGGATAAATAGG - Intergenic
1002615443 5:180451978-180452000 ATTCAGCCATGGGGAAAAATAGG - Intergenic
1003354200 6:5350760-5350782 ATGTTATCATGGGGAGAAATTGG + Intronic
1005573317 6:27167948-27167970 ATTATGTCCTAGTGAAAAAAAGG - Intergenic
1007440404 6:41854541-41854563 ATTTTGTTCTTGGGAAACACTGG + Intronic
1008147636 6:47911100-47911122 ATATTTTCCAGGGGAAAAACTGG - Intronic
1010387415 6:75297880-75297902 ATTTTGTACTGTGGAAACAAAGG - Intronic
1010850127 6:80764680-80764702 ATTTTCTCCTGGGTAACAAGAGG - Intergenic
1011253937 6:85402363-85402385 GTTTTGTCCTGGGGCAAGATGGG - Intergenic
1011258988 6:85452529-85452551 ATTGGGTTCTGAGGAAAAATAGG + Intronic
1011575821 6:88797846-88797868 ACTTTGTACTGTGGAAGAATAGG - Intronic
1011628096 6:89299593-89299615 CTTTTCTCCTTGGGAAAATTAGG + Intronic
1011758923 6:90537761-90537783 TTTTTGTCCTTGGGAAACAGGGG - Intronic
1012127701 6:95452111-95452133 ATTTTTTCCTGAGGTAAATTGGG - Intergenic
1012618235 6:101304315-101304337 ATTTTTTCCTATGGAAAAATAGG - Intergenic
1012722381 6:102762022-102762044 ATTTTGCACAGGGGAAAAATAGG - Intergenic
1013290056 6:108712138-108712160 ATTTTTTCTTGGAGAATAATAGG + Intergenic
1014602034 6:123425151-123425173 ATTTAAGCCTGGGGAAAAAAGGG + Intronic
1015330057 6:131966925-131966947 ATTTTGACCTGGGTCAACATGGG + Intergenic
1015869882 6:137765485-137765507 ATGTTTTCTGGGGGAAAAATGGG - Intergenic
1016279749 6:142402075-142402097 ATTTTGTCCTTGAGAAATAAAGG - Intronic
1016282314 6:142432267-142432289 ATTTTGTCCTGGAGGAATTTTGG + Intronic
1019013175 6:168859452-168859474 TTTCTGTCCTGTGTAAAAATGGG + Intergenic
1019478953 7:1257276-1257298 ATTCTGGCCTGGGGAGCAATGGG - Intergenic
1020044103 7:5027596-5027618 GTTTTGTCTTGAGGAAACATGGG - Intronic
1020842161 7:13232238-13232260 ATTTTGGTTTGGGGAAAACTGGG - Intergenic
1021157782 7:17233216-17233238 ATTTTGTGTTGAGGATAAATAGG + Intergenic
1024503833 7:50143537-50143559 CTTTTGCCCTGTAGAAAAATTGG - Intronic
1024865645 7:53902921-53902943 ATTGTGTCATGGGGCAAAAGTGG - Intergenic
1025078139 7:55961290-55961312 ACTTTTTACTGGGGAAAAAGAGG - Intronic
1025094159 7:56084680-56084702 TTTGTTTCCTGGGAAAAAATCGG - Intronic
1025520055 7:61716295-61716317 ATTGAGTCCTGGGGTGAAATAGG - Intergenic
1025544377 7:62144947-62144969 ATTGAGTCCTGGGGTGAAATAGG - Intergenic
1027470079 7:78562720-78562742 ATAATGTCCTGGGCAATAATTGG + Intronic
1027632634 7:80625926-80625948 TATTTGTCCTGGGGAATTATTGG - Intronic
1029627831 7:101731446-101731468 AATTTATGCTTGGGAAAAATGGG - Intergenic
1029726126 7:102406096-102406118 GCATTGTCCTGGGGAAGAATTGG + Intronic
1031274339 7:119699479-119699501 TTTTTTTCCGTGGGAAAAATAGG - Intergenic
1032524777 7:132571848-132571870 ATTTTTTCCTGGGAGAAAATGGG + Intronic
1034600433 7:152248288-152248310 ATTATGTCCTGAGGAACAGTTGG - Exonic
1035277291 7:157755370-157755392 ATTTAGTCCTGGGTACGAATGGG + Intronic
1035908769 8:3542771-3542793 ATCCTGTCCTGGGGAAAGACTGG - Intronic
1036342562 8:7929464-7929486 AATTTATTCTGGGGAAAAAAAGG + Intronic
1037126485 8:15357359-15357381 TTTTTGTCCTGTGGAAATTTGGG - Intergenic
1037294719 8:17388071-17388093 AATTTCTCCTGAGCAAAAATGGG - Intronic
1040682546 8:49830973-49830995 TTTTTGTCCTGAAGTAAAATGGG + Intergenic
1041320284 8:56605294-56605316 ATTTTTTACTGTTGAAAAATTGG - Intergenic
1041660136 8:60393285-60393307 ACTTTGTCTTGGGGAAAGGTGGG - Intergenic
1041706342 8:60850185-60850207 AATTAGATCTGGGGAAAAATAGG + Intronic
1042580283 8:70269680-70269702 AGTTTGTCTTAGTGAAAAATTGG - Intronic
1043139226 8:76567256-76567278 ATTATGTCCTGTGGAAAACTGGG - Intergenic
1043344769 8:79286608-79286630 ATTTTGTCCCTGGGAAACTTAGG + Intergenic
1044210270 8:89541759-89541781 ACTTTCTCCTGTGGGAAAATGGG + Intergenic
1045991734 8:108315990-108316012 ATTTTGAGCAGGGGAAATATTGG - Intronic
1046061911 8:109150421-109150443 TTTTGGTGCTGGGGAGAAATGGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050199070 9:3122526-3122548 GTTTTGTACTGGTGCAAAATTGG - Intergenic
1050339701 9:4623355-4623377 ATATTCTCCTAAGGAAAAATTGG + Intronic
1050501817 9:6306239-6306261 ACTTTGTCCTGAGAAAAAACAGG + Intergenic
1051097560 9:13483976-13483998 TTTTTCTCCTGGAGAAAATTTGG + Intergenic
1052023867 9:23554126-23554148 ATTTTTTCCTGGGTATAAAGTGG - Intergenic
1052182294 9:25544508-25544530 ATTGTGCTCTGGTGAAAAATAGG - Intergenic
1053003998 9:34592420-34592442 ATTTGCGCCTGGGGAAATATGGG + Intergenic
1055145400 9:72928024-72928046 ATTTTGTCCCGGAGTAAAGTAGG + Intronic
1055515939 9:77032973-77032995 AATTTATCCTGGGAAACAATAGG + Intergenic
1057130432 9:92650838-92650860 ATCTGGTGCTGGGGAAATATTGG - Intronic
1058109945 9:101021426-101021448 ATTTTTTTATGGTGAAAAATTGG + Intergenic
1059998615 9:119938095-119938117 ATTTTTTGCTGGAGAAAAATAGG - Intergenic
1203585102 Un_KI270746v1:60755-60777 ATTATGTCCTGAGGAACAGTTGG - Intergenic
1185654561 X:1673678-1673700 CTTTTGTCCTTGGAAAACATTGG - Intergenic
1186336785 X:8598356-8598378 ATTTTTTCCTAAGGAAAAATAGG - Intronic
1188387545 X:29579567-29579589 ATCTTGCCCTTGGGAAAAAATGG - Intronic
1189906267 X:45763173-45763195 AGTTTGTCATGAGGAAAAATGGG + Intergenic
1191036569 X:56031179-56031201 ATTTTGTCTTGAGAAAACATGGG - Intergenic
1191977196 X:66886283-66886305 ATTTTTTGCAGGGGATAAATTGG + Intergenic
1192478870 X:71467718-71467740 ATTTTGTCATCTGTAAAAATAGG - Intronic
1193203878 X:78725063-78725085 GTTTTGTGCTGGTGAAAAATGGG + Intergenic
1195095779 X:101499798-101499820 ATAATGTCCTGGGGGGAAATAGG + Intronic
1196656653 X:118225617-118225639 GTTTGCTCCTGGGGCAAAATGGG - Intergenic
1198837475 X:140819992-140820014 ATTATGTCCTGGGGTTAACTTGG + Intergenic
1199154431 X:144529963-144529985 ATTTTCTTATGGGCAAAAATAGG - Intergenic
1201270161 Y:12246481-12246503 ATTTTGTCTTGAGAAAACATGGG + Intergenic
1201890368 Y:18937243-18937265 ATTTTGTACTGGTGAAATCTGGG + Intergenic