ID: 972805404

View in Genome Browser
Species Human (GRCh38)
Location 4:42525169-42525191
Sequence AGGTATTCATAGGTGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972805401_972805404 -8 Left 972805401 4:42525154-42525176 CCAGAACACCTTCATAGGTATTC 0: 1
1: 0
2: 0
3: 3
4: 96
Right 972805404 4:42525169-42525191 AGGTATTCATAGGTGCTGCAAGG No data
972805397_972805404 10 Left 972805397 4:42525136-42525158 CCTAACCCAGAAGGTTTTCCAGA 0: 1
1: 0
2: 3
3: 19
4: 239
Right 972805404 4:42525169-42525191 AGGTATTCATAGGTGCTGCAAGG No data
972805398_972805404 5 Left 972805398 4:42525141-42525163 CCCAGAAGGTTTTCCAGAACACC 0: 1
1: 0
2: 1
3: 13
4: 170
Right 972805404 4:42525169-42525191 AGGTATTCATAGGTGCTGCAAGG No data
972805396_972805404 11 Left 972805396 4:42525135-42525157 CCCTAACCCAGAAGGTTTTCCAG 0: 1
1: 0
2: 1
3: 33
4: 326
Right 972805404 4:42525169-42525191 AGGTATTCATAGGTGCTGCAAGG No data
972805399_972805404 4 Left 972805399 4:42525142-42525164 CCAGAAGGTTTTCCAGAACACCT 0: 1
1: 0
2: 1
3: 17
4: 184
Right 972805404 4:42525169-42525191 AGGTATTCATAGGTGCTGCAAGG No data
972805394_972805404 30 Left 972805394 4:42525116-42525138 CCACATGCTGCAAGATCTACCCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 972805404 4:42525169-42525191 AGGTATTCATAGGTGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972805404 Original CRISPR AGGTATTCATAGGTGCTGCA AGG Intronic
No off target data available for this crispr