ID: 972810036

View in Genome Browser
Species Human (GRCh38)
Location 4:42573763-42573785
Sequence CTTACTGCTCAGAGTGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972810036 Original CRISPR CTTACTGCTCAGAGTGAGTG GGG Intronic
901243883 1:7713124-7713146 CTGACCACACAGAGTGAGTGAGG + Intronic
902137755 1:14325233-14325255 TTTAATGCTCAGAGTGATGGTGG - Intergenic
903767452 1:25743864-25743886 GTAACTGATCAGAGTGGGTGGGG + Intronic
904761389 1:32807024-32807046 CCTCCTGCTCAGAGGGAGTCTGG + Intronic
908090585 1:60681524-60681546 ATTACTGCCCAAACTGAGTGTGG - Intergenic
909136106 1:71802518-71802540 TTTACTTCTCAGAGAGGGTGGGG + Intronic
918069340 1:181123376-181123398 CTTAGTGCTCACCGTGAGTCAGG + Intergenic
919382203 1:196873267-196873289 CTCCCTGCTCAGAGTAAGGGTGG + Intronic
923760945 1:236843468-236843490 ATTGTTACTCAGAGTGAGTGGGG + Intronic
1063986457 10:11509181-11509203 CATACTGCTCAGAAAGAGAGAGG - Intronic
1065207924 10:23374762-23374784 CTTACTGCTCAGGGTTCATGTGG - Intergenic
1065895885 10:30162960-30162982 CTCACTGCCCAGGGTCAGTGGGG - Intergenic
1067575799 10:47407541-47407563 CCTAGTGGACAGAGTGAGTGGGG + Intergenic
1068657547 10:59591050-59591072 CTTAAGGCTCACAGTGTGTGTGG - Intergenic
1070526740 10:77302076-77302098 CTTCCTTCTCACAGTAAGTGGGG + Intronic
1073259158 10:102175599-102175621 CTTCCTGCTCTGAATGAGAGTGG + Intergenic
1076459843 10:130634387-130634409 CCTAGTGCTCAGAGCCAGTGGGG + Intergenic
1076497044 10:130904186-130904208 GTCAGTGCTGAGAGTGAGTGGGG + Intergenic
1078065031 11:8072663-8072685 CCTACTGCACATAGTGTGTGAGG - Intronic
1078584116 11:12565906-12565928 CTGACTGATCAGGGTGGGTGGGG + Intergenic
1078798387 11:14617080-14617102 CTGCCTGCTGAGAGTGGGTGTGG + Intronic
1081829867 11:46100111-46100133 CTTACTTATCAGCGTGATTGAGG - Intronic
1083332667 11:61906209-61906231 CCTACTGCTTGGAGTCAGTGGGG + Intronic
1084998971 11:73011590-73011612 CTTAGTTCTCAGAGCGTGTGTGG + Intronic
1092205357 12:6611508-6611530 CTTAGTACTCAGAGTAAGTATGG - Intergenic
1096490460 12:52010088-52010110 CCTGCTGTTCAGAGTGAGAGGGG + Intronic
1096912970 12:55002613-55002635 CTCATTGCTCAGAGTGGTTGGGG - Intergenic
1098149632 12:67533250-67533272 CTTAGTGCTCAGAGGAACTGAGG + Intergenic
1098587836 12:72175597-72175619 CTTAGTTCTCAGAGTCAATGAGG + Intronic
1100212337 12:92410446-92410468 CTCACTGCTCAGAGTGACATAGG - Intergenic
1101097420 12:101357187-101357209 ATTACTGCTCAGAGTGTCAGTGG - Intronic
1103773827 12:123350392-123350414 CTTGCTGCTTTGAGTGAGAGTGG - Exonic
1107694538 13:42987253-42987275 CTAACTACTCAGAGTTAGTGTGG - Intronic
1108276974 13:48820929-48820951 GTGCCTGCACAGAGTGAGTGAGG + Intergenic
1109879572 13:68453267-68453289 CTTACTGCTGACAGGGAGAGGGG - Intergenic
1112884232 13:104148649-104148671 CTAACTATTCAGAGTGATTGTGG - Intergenic
1113707758 13:112445465-112445487 CTTTCTGGTCAGAGTGGGAGGGG - Intergenic
1115742392 14:36402402-36402424 GTGATCGCTCAGAGTGAGTGTGG - Intergenic
1117151692 14:52895202-52895224 GTTACTACTCAGTGTCAGTGAGG + Intronic
1118505892 14:66411456-66411478 CTTCCAGCTCAGAGTAACTGGGG - Intergenic
1119102807 14:71895880-71895902 ATTTCTGCTCAGAGAGAGCGAGG + Intergenic
1120092444 14:80348488-80348510 CTTACAGCTCAGCATGACTGAGG + Intronic
1121006703 14:90495418-90495440 GTCCCTGCTCAGGGTGAGTGAGG - Intergenic
1121784899 14:96649959-96649981 CTTAAAACTCAGAGTGTGTGTGG + Intergenic
1122820014 14:104337522-104337544 CTGGCTGCTCAGACAGAGTGGGG - Intergenic
1125296496 15:38208927-38208949 CTAACTGCACAGCCTGAGTGAGG + Intergenic
1126839227 15:52699981-52700003 CTTAATGCTCAGAATATGTGTGG + Intronic
1127134765 15:55908529-55908551 CTTACTTCTCAAAGTGTGTCTGG + Intronic
1128160183 15:65418537-65418559 CTCACTGCTGAGGCTGAGTGAGG - Intronic
1128571858 15:68739410-68739432 CTAACTACCCAGAGTTAGTGTGG - Intergenic
1129235499 15:74221581-74221603 CTTCCTGCTCTGTGTGGGTGGGG + Intergenic
1130638286 15:85646114-85646136 CATGCCTCTCAGAGTGAGTGAGG - Intronic
1132050031 15:98599955-98599977 CTTGCTGCTCAGGATGAATGGGG + Intergenic
1133303747 16:4797832-4797854 CTCACTGCCCACAGCGAGTGGGG - Exonic
1136224410 16:28848998-28849020 TTTACTGCTCAGATAAAGTGAGG + Intronic
1141274050 16:82568922-82568944 ACTCCTGCTCAGAGAGAGTGTGG - Intergenic
1141912223 16:87067875-87067897 TTTACGGCTCTGAGTGTGTGGGG + Intergenic
1141999239 16:87654733-87654755 CTTACTGCGCAGCGAGCGTGTGG - Intronic
1144679755 17:17185187-17185209 CTTAATACTGACAGTGAGTGTGG - Exonic
1148405002 17:47404317-47404339 ATTACTGGTCAGAGTTACTGGGG + Intronic
1148459816 17:47832969-47832991 CTTACTACTCAGAGTATGTGTGG + Intronic
1149573983 17:57698206-57698228 GTTCCTGCTCAGAGAGAGGGTGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151228007 17:72660997-72661019 AAAACTGCTCAGACTGAGTGTGG + Intronic
1151584223 17:74998923-74998945 CTTAATACTGACAGTGAGTGTGG - Intronic
1153102572 18:1490406-1490428 ATTACTTCTCAGAATGAGAGTGG + Intergenic
1155901189 18:31393223-31393245 CTTACTACACAGTGTGATTGTGG + Intronic
1158264674 18:55648990-55649012 CTTTCTGCTGAGAGCCAGTGGGG + Intronic
1160136322 18:76274611-76274633 CACACTGCTCAGAGTGAGCTGGG - Intergenic
1161286704 19:3472141-3472163 CTCGCTGCTGAGGGTGAGTGGGG - Intergenic
1162154982 19:8671504-8671526 CTGACTGCTCAGAGTCACTCTGG + Intergenic
1164686372 19:30169120-30169142 CTTCCTGCTCAGAGGGAGGAGGG + Intergenic
1164835617 19:31353402-31353424 CTTACTTTTCAGAGTGACTCAGG - Intergenic
1164923220 19:32105215-32105237 TTTCCTGCTCTGAGTGAGCGGGG - Intergenic
1168188320 19:54716478-54716500 CTCACTTCTCAGAGTGGTTGTGG - Intergenic
925987060 2:9225240-9225262 GTTAGAGCTCTGAGTGAGTGTGG + Intronic
926913314 2:17871352-17871374 GTTACTGCTTACAGAGAGTGGGG + Intergenic
930606134 2:53495374-53495396 CCTGATGCTCAGAGTGAGAGAGG - Intergenic
934196920 2:89844841-89844863 GTTACTGCTCAGAGAGAATGAGG - Intergenic
934723990 2:96603208-96603230 CTTACTGCTTTGATTGTGTGAGG - Intronic
935492395 2:103736033-103736055 CTTACGGCTCAGGGGGTGTGTGG + Intergenic
937449148 2:121986611-121986633 CCTAATTCTCAGAGAGAGTGGGG - Intergenic
939025118 2:137003342-137003364 TTAACTGCTCAGAGGGAGAGAGG + Intronic
942745234 2:179224636-179224658 TTTCCTTCTCAGAGTTAGTGGGG - Intronic
947788112 2:232842885-232842907 CTAACTGCACAGAGTGCGGGAGG + Intronic
1171774014 20:29349223-29349245 CTTAGTGTTCAGCATGAGTGGGG + Intergenic
1173922295 20:46755430-46755452 GTTCTTGCTCTGAGTGAGTGAGG - Intergenic
1175910313 20:62402166-62402188 TTTAGTGCTGAGAGTGAGTGAGG - Intronic
1176185190 20:63774565-63774587 CATGCGGCTGAGAGTGAGTGAGG - Intronic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179745835 21:43443897-43443919 CTTCCTGCTCAGAGTCCTTGGGG - Intergenic
1181472778 22:23151145-23151167 CAAACTGCACAGAGTGGGTGAGG + Intronic
1182196438 22:28523438-28523460 ATGACTGCCCAGAGTGAGTATGG - Intronic
949208059 3:1464731-1464753 CGTGTTGCTCAGAGTGGGTGAGG - Intergenic
949256739 3:2057015-2057037 CTTATTTCTCAGTGTGGGTGTGG + Intergenic
949673594 3:6427041-6427063 CTGACTGCTCACACTGAGTTGGG - Intergenic
953626636 3:44577619-44577641 CTTAATACTGACAGTGAGTGTGG + Intronic
955210808 3:56939106-56939128 CTTCCTCTTCACAGTGAGTGTGG - Intronic
957476983 3:80738545-80738567 CTTACAGTTCAGAGTGTCTGGGG + Intergenic
958671671 3:97213482-97213504 CATAATGCTCAGAGAGAATGTGG - Intronic
960078321 3:113513985-113514007 CTTACTGCATAGAGTTAGTTAGG - Intronic
961861328 3:129918863-129918885 CTCACTGGGCAGTGTGAGTGTGG - Intergenic
962317109 3:134365807-134365829 CTGCTTGCTCAGAGTGAGTAGGG - Exonic
965836475 3:172858906-172858928 GTTACTGTTCAGAGTGCTTGAGG + Intergenic
967582588 3:191177926-191177948 CTTACTGTTCAGCATGACTGGGG + Intergenic
968088231 3:195884031-195884053 CTTACTGCTCAGATCACGTGCGG - Intronic
969849192 4:9943214-9943236 CCCAGGGCTCAGAGTGAGTGGGG + Intronic
970676535 4:18456726-18456748 GTTCCTGGTCTGAGTGAGTGTGG + Intergenic
972810036 4:42573763-42573785 CTTACTGCTCAGAGTGAGTGGGG + Intronic
975383404 4:73727955-73727977 CTGAATGCTCAGAGTCAGTGAGG - Intergenic
976687837 4:87835651-87835673 CTTGTTGCACAGAGTGTGTGCGG - Intronic
980502838 4:133679059-133679081 TTTCCTGGTCTGAGTGAGTGTGG - Intergenic
983090970 4:163501873-163501895 CTTACTTCCCAAAGTGAGTCAGG + Intronic
983529507 4:168794707-168794729 CTTACTGCTCACAGCCTGTGGGG + Intronic
993932832 5:93962612-93962634 CTTAAATCTCAGAGTGAGAGTGG - Intronic
996228479 5:121031717-121031739 TTTACAGCACACAGTGAGTGGGG - Intergenic
997182143 5:131841208-131841230 CTTACTGCACTGGGTGAGAGTGG + Intronic
999107326 5:149085349-149085371 CTTGCTGCACAGAGTGGGTGGGG - Intergenic
1000485255 5:161833703-161833725 CTTACTTCTCATAGTGAAAGAGG - Intergenic
1000498310 5:162014122-162014144 CTCACTGCTCAGCATGACTGGGG - Intergenic
1003886697 6:10528122-10528144 CTTACTGCACAAAGTGACTGTGG - Intronic
1004082057 6:12404457-12404479 CTGCCTGGTCAGAGTGAGTCAGG + Intergenic
1005140671 6:22628010-22628032 CCTAATGCTCAGAGAAAGTGTGG - Intergenic
1005954173 6:30651958-30651980 CTTACTGAACAGACTGGGTGTGG + Intronic
1006098081 6:31668675-31668697 CTTACTGCTCAGAAGGAGGCAGG - Intronic
1007262875 6:40575914-40575936 CCTACTGCACAGAATGAATGTGG + Intronic
1010201273 6:73284224-73284246 CTTACTGCTCAGAAGGTATGTGG + Intronic
1010687975 6:78874338-78874360 GTTACTGCTCAGAGGTAGTAGGG + Intronic
1010710179 6:79164794-79164816 CCTACTGCTGTGAGTGTGTGTGG - Intergenic
1012931435 6:105321652-105321674 CTTACTGCTTAGTATGATTGGGG - Intronic
1013952383 6:115798749-115798771 ATTCCTGCTCAGAGAGAGTCTGG - Intergenic
1014857323 6:126417687-126417709 CTTACTGTTCCAAGTGACTGGGG - Intergenic
1016514017 6:144873683-144873705 CTTACTGCTCAGAGTCATGTGGG + Intergenic
1016745634 6:147576489-147576511 CTTTATGCTCAGAGTCTGTGTGG + Intronic
1019608522 7:1923019-1923041 CTTGCTTCACAGAGTGAGTTGGG + Intronic
1019766237 7:2852967-2852989 CTCACTGCTGGGTGTGAGTGTGG + Intergenic
1019894071 7:3969407-3969429 CTTACTCCACACAGTGAGCGTGG - Exonic
1021622698 7:22564076-22564098 CTTTCTGCTCAGGGTGACTGTGG + Intronic
1021891790 7:25193694-25193716 TTCACTGGTGAGAGTGAGTGAGG + Intergenic
1024381532 7:48702596-48702618 CTTACAGCCCACAGTGGGTGGGG + Intergenic
1026873621 7:73867726-73867748 CTTACAGCTCAGGGTGGATGTGG + Intergenic
1030251149 7:107446639-107446661 CTGACTTCCCAGTGTGAGTGGGG - Intronic
1031743032 7:125457921-125457943 CTGACTTCTCAGAGTGGCTGGGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1035815363 8:2533560-2533582 CTCACTGCTCAGAACTAGTGTGG + Intergenic
1037433608 8:18840241-18840263 CCTATTACTCAGAGTGATTGAGG - Intronic
1038053007 8:23831058-23831080 CTTACTTCTCAGAGTCATTGGGG + Intergenic
1038090883 8:24251799-24251821 CTGACTGCTCACTGTAAGTGGGG - Intergenic
1038679061 8:29650040-29650062 CCTAATGCTCAGAGTCACTGAGG + Intergenic
1040107964 8:43550730-43550752 CTTCCACCTCAGAGTGCGTGGGG - Intergenic
1041635111 8:60134212-60134234 CTTTCTGCTCACTGTGAGTCCGG - Intergenic
1045172219 8:99684397-99684419 CTTAATGCTCAGAGGGACTAGGG - Intronic
1048678532 8:136812628-136812650 TTCACTGCCCAGAGTGAATGTGG + Intergenic
1048797732 8:138167020-138167042 CATCCTGGTCAGAGTGAGTGTGG - Intronic
1050687854 9:8191327-8191349 CTCACTGCTCAGCCTGGGTGAGG - Intergenic
1051924803 9:22310780-22310802 CTTACTGCTCAGAGATCATGTGG - Intergenic
1052058740 9:23933979-23934001 CTTATTGCTAAGTCTGAGTGAGG + Intergenic
1056400250 9:86220457-86220479 CCTACTCCTCAGAGAGAGTTTGG + Exonic
1057912047 9:99026745-99026767 CTTTCTGCTCATAATGAGTCAGG - Intronic
1058215710 9:102230871-102230893 CTTACTGCTTTTAGTAAGTGTGG - Intergenic
1060101173 9:120842498-120842520 CTCACTGCTCAGAGGCAGCGAGG + Intronic
1060828169 9:126698179-126698201 CTTACTGTTTAGACTGAATGAGG + Exonic
1203638555 Un_KI270750v1:136618-136640 CTTGCTGTTCAGCGTGAGTTGGG + Intergenic
1185462251 X:338768-338790 CTCCCTGCTCAGGGTGAGTGCGG - Exonic
1186127346 X:6428106-6428128 CTTCATCCTTAGAGTGAGTGTGG - Intergenic
1186603321 X:11062080-11062102 ATTACTGCTCATTTTGAGTGTGG - Intergenic
1187343498 X:18442200-18442222 TTTAGAGCTCTGAGTGAGTGGGG + Exonic
1189030575 X:37445299-37445321 CTTACTGCTCAAAGTTGGTCTGG + Intronic
1189066077 X:37810626-37810648 CATATTGCTCAGAGGGAGTGTGG - Intronic
1189708753 X:43786787-43786809 CTTCCTTCTCAGAGTGAATCTGG + Intronic
1193687500 X:84595605-84595627 CAGACTGCTGAGAGTGAGAGAGG - Intergenic
1199227148 X:145390816-145390838 CTTACTTCAGAGAGTGAGTTAGG + Intergenic