ID: 972814405

View in Genome Browser
Species Human (GRCh38)
Location 4:42628399-42628421
Sequence GCTGGAGCACAGACAGAAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 7, 3: 73, 4: 468}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972814405 Original CRISPR GCTGGAGCACAGACAGAAGG CGG Intronic
900125198 1:1065833-1065855 GCTGAAGCAGAGAGAGAAGGCGG + Intergenic
900457472 1:2784232-2784254 GCTGAAGCAGAGATAGAAGGTGG + Intronic
900523620 1:3117748-3117770 GCTGGAGCACAAGGACAAGGCGG - Intronic
900553824 1:3269947-3269969 GGAGGAGGACAGTCAGAAGGAGG + Intronic
900859512 1:5218087-5218109 GCTGGAGCACAGACAACAAGGGG - Intergenic
900955097 1:5881926-5881948 GCTCGTGCGCAGACAGTAGGAGG - Intronic
900996059 1:6124288-6124310 GTTGGAGGACACACAGAGGGTGG - Intronic
901962796 1:12840787-12840809 GATGGAGAAAAGACAGAAGGAGG - Intergenic
901969361 1:12895274-12895296 GATGGAGAAGAGACAGAAGGAGG - Intronic
901989987 1:13105090-13105112 GATGGAGAAAAGACAGAAGGAGG - Intergenic
902005039 1:13225539-13225561 GATGGAGAAGAGACAGAAGGAGG - Intergenic
902007865 1:13246414-13246436 GATGGAGAAGAGACAGAAGGAGG + Intergenic
902015812 1:13306506-13306528 GATGGAGAAGAGACAGAAGGAGG + Intronic
902024265 1:13371333-13371355 GATGGAGAAGAGACAGAAGGAGG - Intronic
902026843 1:13390209-13390231 GATGGAGAAGAGACAGAAGGAGG + Intronic
902382194 1:16057995-16058017 GCTGGGGGGCAGACACAAGGAGG + Exonic
902678795 1:18028671-18028693 GCTGCAGAACAGCCGGAAGGAGG + Intergenic
902743825 1:18459674-18459696 GCTGGAGAAGAGAAAGAAAGAGG - Intergenic
902940030 1:19794206-19794228 ATTTGAGCACAGACAGAAGGAGG - Intronic
903543272 1:24108546-24108568 GCTGGAGCACCGGCAGGAGGAGG - Exonic
903768400 1:25749233-25749255 TCTGCAGGACAGAAAGAAGGAGG - Exonic
904224915 1:29008776-29008798 GCTGGAGCACAGAGGCAAAGAGG - Intronic
904284194 1:29443532-29443554 CCTGGAGCCCAGGCAGGAGGTGG + Intergenic
906213917 1:44028210-44028232 GCTGGAGCTCAGACAGTCAGGGG + Intronic
906288971 1:44607397-44607419 GCTGGAGCACAGAGAGTGAGGGG - Intronic
906376104 1:45297875-45297897 GCTGGATCACAGACAAAGGCAGG + Intronic
907472595 1:54683678-54683700 GCTGGAGCAAAGCAAGCAGGAGG - Intronic
909924840 1:81427109-81427131 GCTGGATCACAGAGAGATTGTGG + Intronic
911319626 1:96396667-96396689 GCTGGAGCAGAAACTGAAGTGGG + Intergenic
911330814 1:96523661-96523683 ACTGGAGCAGAGACAGAGGTGGG - Intergenic
911627759 1:100145443-100145465 ACTGCAGCAGAGACAAAAGGAGG - Intronic
911813244 1:102310912-102310934 ACAGGAACACAGCCAGAAGGTGG + Intergenic
912142137 1:106743342-106743364 GCTGCACCATAGATAGAAGGAGG - Intergenic
912827083 1:112915410-112915432 GCTGGGGCACAGAGAGCAGGAGG + Intronic
913059169 1:115188936-115188958 GCTGCAGGACAGATAGAGGGAGG - Intergenic
913465150 1:119132946-119132968 GCAGAAGTACAGTCAGAAGGTGG - Intronic
915007638 1:152655086-152655108 GCTGGATCACAGACTGAATTAGG + Intergenic
915084841 1:153379121-153379143 GCAGGAGAACAGACATCAGGTGG + Intergenic
916414231 1:164577490-164577512 GCTGGAGCCCAGGCAGGAAGGGG + Intronic
916759473 1:167803568-167803590 GCTGAATCACAGCCAGATGGAGG + Intergenic
917428722 1:174943113-174943135 GCTGGAGCACAGTGAGGAGAGGG - Intronic
917574409 1:176305695-176305717 GCAGGAGCAAAGACATATGGTGG - Intergenic
917757356 1:178115595-178115617 GCTGGAGCACAGATAGTGAGAGG + Intronic
919909904 1:202104545-202104567 GTAGAGGCACAGACAGAAGGAGG + Intergenic
922606307 1:226891884-226891906 GCGGGAGCGGAGACAGAGGGTGG + Intronic
922987584 1:229877888-229877910 GCAGGAGCGCAGACAGACGTGGG - Intergenic
923436104 1:233969483-233969505 CCAGGAGAACAGACAGGAGGTGG - Intronic
924517680 1:244780096-244780118 GCTGGGGGACAGTGAGAAGGTGG - Intergenic
1065200335 10:23306570-23306592 GCTGGAGCACAGGGAAAATGGGG + Intronic
1065668163 10:28085255-28085277 ACTGAAGCACAGAGAGAAGTAGG - Intronic
1065934752 10:30511438-30511460 GCTTGAGCTCAGAGAGAAAGTGG - Intergenic
1066333072 10:34446175-34446197 GCTAGAGCACAGAGCTAAGGTGG + Intronic
1067104947 10:43360404-43360426 GATGGAGCACAGAGAGTAGGCGG + Intergenic
1068369047 10:56090364-56090386 CCTGGATAACAGACAGAAGTTGG + Intergenic
1069100183 10:64310391-64310413 GGAGGGGCACAGACAGTAGGTGG + Intergenic
1069812225 10:71170493-71170515 GCTGTAGCACAGCAACAAGGTGG + Intergenic
1070301345 10:75205988-75206010 CCTTGAGCACAGTCAGATGGAGG - Intergenic
1070373842 10:75810158-75810180 GCTGGAGTTCAGAGAGCAGGTGG + Intronic
1070525485 10:77292566-77292588 GCTGAAGAACAGACAGGAGAGGG - Intronic
1070628567 10:78068217-78068239 CCAGGGGGACAGACAGAAGGAGG + Intergenic
1070714824 10:78711817-78711839 GATGGAGGACAGCTAGAAGGTGG - Intergenic
1070716662 10:78727325-78727347 GGTGGACAACAGACAGCAGGAGG + Intergenic
1070802167 10:79250233-79250255 ACTGAGGCTCAGACAGAAGGGGG - Intronic
1070957049 10:80471076-80471098 GCTGGAGGGCAGAGAGAAGGAGG - Intronic
1071103416 10:82065578-82065600 GCTGAATTACTGACAGAAGGGGG + Intronic
1073507270 10:104008335-104008357 GCTGAAGAACCGAAAGAAGGAGG + Exonic
1073618964 10:105027086-105027108 GCTGGAGCACAGCGAGCAGGAGG - Intronic
1074772549 10:116742987-116743009 CCTGGGGGACAGACAGAAGCTGG - Intergenic
1075103021 10:119519265-119519287 GCTGGGGGACAGACACAGGGAGG - Intronic
1075312413 10:121425590-121425612 GCTGGAGCACAGGCCAAAGTTGG - Intergenic
1075438547 10:122461972-122461994 GCTGGCGCACACACAGAGGCCGG - Exonic
1075845578 10:125542593-125542615 GCTGGTGCACAGGCAGAGGATGG - Intergenic
1075859305 10:125661237-125661259 GATGGAGCAGACACAGGAGGGGG + Intronic
1076349008 10:129801882-129801904 GCTGGAGGGGAGGCAGAAGGGGG + Intergenic
1076880135 10:133235937-133235959 GCTGAACCACGTACAGAAGGGGG + Intergenic
1076998085 11:308833-308855 GCTGGGGCCAAGGCAGAAGGAGG + Intronic
1076999306 11:314752-314774 GCTGGGGCCAAGGCAGAAGGAGG + Intronic
1077057471 11:601880-601902 TCTGTAGCACAGACTGAAGATGG + Intronic
1077082320 11:729547-729569 GCAGGTCCACAGAAAGAAGGAGG + Intergenic
1078421761 11:11218467-11218489 GCTGGAGCCAAGACTGCAGGAGG - Intergenic
1079077983 11:17395530-17395552 TCTGGAGCACAAAGAGGAGGGGG - Intronic
1079917098 11:26382652-26382674 GCTTGCGAACAGACAGAAGTGGG - Intronic
1081398293 11:42613183-42613205 GCTTGGGCACAGACAGAAATAGG - Intergenic
1081646954 11:44796745-44796767 CCTAGAGGACAGACAGAGGGTGG - Intronic
1084150171 11:67284453-67284475 CCTGGATCACAGCCAGAAAGTGG + Intronic
1084335813 11:68457268-68457290 TCAGGAGGAAAGACAGAAGGTGG + Intergenic
1084531609 11:69730985-69731007 GCCAGAGCACAGAGAGAAGGAGG - Intergenic
1084641469 11:70429109-70429131 GCAGGAGGACAGGCGGAAGGCGG + Exonic
1085254954 11:75167149-75167171 GCTGCAGCTTAGAGAGAAGGTGG + Intronic
1085315339 11:75541473-75541495 GCTGGAGCCCAGGCAGCAGATGG - Intergenic
1086142271 11:83512291-83512313 GCTGGAGCTCAGAGAAATGGTGG + Intronic
1087622679 11:100560277-100560299 GCTAGAGCAAAGATAGGAGGTGG - Intergenic
1087946283 11:104164203-104164225 GCTGCAGCACAGGCTGCAGGGGG + Intronic
1088507649 11:110542045-110542067 GATGGGGGACAGACAGAGGGAGG + Intergenic
1089171022 11:116511529-116511551 GATGGAGGGGAGACAGAAGGGGG + Intergenic
1089257363 11:117200910-117200932 GCAGGGCCAGAGACAGAAGGTGG + Intronic
1090334213 11:125951837-125951859 GCTGGAGCACAGCCACAATGGGG + Intergenic
1090436959 11:126695056-126695078 GATGGCTCGCAGACAGAAGGGGG - Intronic
1090876983 11:130798931-130798953 TGTGGGGCACAGAGAGAAGGTGG + Intergenic
1090961531 11:131561642-131561664 GCTGGGGGACAGGCAGGAGGTGG + Intronic
1091260387 11:134229471-134229493 GCTGAAGCAGAGACAGAGAGAGG - Intronic
1091794106 12:3287569-3287591 GCTGGACCTTAGACAGAGGGTGG - Intergenic
1091938251 12:4450649-4450671 GCTGGAGCATAGTAAGGAGGGGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095598067 12:43981389-43981411 GCTGGAGCACAGAAAGAGGAAGG + Intronic
1095883879 12:47168227-47168249 GCTACAGAAGAGACAGAAGGAGG - Intronic
1095986964 12:48005151-48005173 TCTGGAGCACAGGCCGAAGTTGG + Intergenic
1096539621 12:52298201-52298223 GCTGGAGCAGAGATTGAAGGAGG + Intronic
1096621541 12:52868782-52868804 GCTGGAGAACAGACAGATGCAGG - Intergenic
1097347132 12:58505944-58505966 GGTGGAGGCCAGACAGAAGAGGG - Intergenic
1097961185 12:65533399-65533421 GCAGCAGCAGAGACAGGAGGAGG - Intergenic
1098076536 12:66737999-66738021 GAAGGAGGGCAGACAGAAGGGGG + Intronic
1098249156 12:68550840-68550862 GCTGGAGCACAGTGAGGAAGGGG - Intergenic
1098997431 12:77136822-77136844 GCTGGACCACAAGCTGAAGGTGG + Intergenic
1100981181 12:100164016-100164038 GGAGCAGCACAGACAAAAGGTGG - Intergenic
1101032996 12:100678211-100678233 GCTGGAGCAGAGAGAGCAAGCGG - Intergenic
1101496456 12:105259128-105259150 GCTGCAGCACAGGCAGAGGTTGG - Intronic
1101613792 12:106316411-106316433 GCTGAAGCACAGCAAGCAGGAGG - Intronic
1101834250 12:108284183-108284205 GAGGGAGCAAAGACAGAAGTGGG + Intergenic
1102348206 12:112172953-112172975 CCTGGAGCACATTCAGAAGACGG + Intronic
1102588780 12:113941948-113941970 GCTGGAGAACAGGCACATGGAGG + Intronic
1102899953 12:116628687-116628709 GCTGGAGCAGAGAGAGCCGGCGG - Intergenic
1103795194 12:123498558-123498580 GGGGGAGCACAGCCAGAATGGGG - Exonic
1103885811 12:124199229-124199251 CCGGGAGGACAGACAGAAGGCGG + Intronic
1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG + Intronic
1104564179 12:129865326-129865348 GCTGGAGCATAGAGAGCAGAAGG + Intronic
1104636661 12:130441881-130441903 GCTGGAGCAAAGGGAGAAGAAGG - Exonic
1104947354 12:132422043-132422065 GCAGGAGGACAGTGAGAAGGAGG + Intergenic
1104948143 12:132426469-132426491 CGTGGAGGACAGAGAGAAGGCGG - Intergenic
1105376681 13:19851957-19851979 GCTGGAGCAGAAATTGAAGGAGG + Exonic
1106143941 13:27035300-27035322 GCTGGAGCAGAGAGAGGAGAAGG + Intergenic
1107291586 13:38860289-38860311 GCTGGAGCAAAGACACATTGGGG + Intronic
1107701672 13:43054936-43054958 CCTGGAGCACAGAAGGAGGGCGG + Intronic
1108423075 13:50270696-50270718 GCTTGGGGACAGACTGAAGGGGG - Intronic
1110103117 13:71634401-71634423 CCTGGAGCACAGAGAGCAAGGGG - Intronic
1110187801 13:72694994-72695016 ACTGGAGCACAGACTGACTGGGG + Intergenic
1110910099 13:80949101-80949123 GCTGGAGGAAAGACAGAAAGTGG + Intergenic
1111695461 13:91617981-91618003 GCTGGAGCAAAAATAGAAGAAGG - Intronic
1114484969 14:23056949-23056971 GCTGGGGACCAGAGAGAAGGCGG + Intronic
1114529642 14:23387857-23387879 GCTGGAGTCCTCACAGAAGGAGG - Exonic
1115278289 14:31632401-31632423 GCAGGAGATCAGAAAGAAGGAGG - Intronic
1117060468 14:51957202-51957224 GATGCAGGATAGACAGAAGGTGG - Intronic
1118364533 14:65083100-65083122 GCTGCAGCATAAACAGTAGGAGG - Intronic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1118636871 14:67755959-67755981 GCTGCAGCTCATACAGAATGTGG + Exonic
1121073265 14:91044498-91044520 CCTAGAGGTCAGACAGAAGGGGG + Intronic
1121452882 14:94020572-94020594 GCTGGAGCACAGGAATAAAGGGG - Intergenic
1121506186 14:94479349-94479371 TCTGGGGCAAGGACAGAAGGTGG - Intronic
1121519424 14:94575964-94575986 GCTGGAGAACAGACCAAATGGGG + Intronic
1121816641 14:96933846-96933868 CCTGGAGGACAGAAAGAGGGGGG + Intergenic
1123189525 14:106555591-106555613 GCTGCAGGACGGGCAGAAGGAGG - Intergenic
1123896523 15:24836118-24836140 GTGAGAGCACAGAGAGAAGGTGG - Intronic
1124199244 15:27663072-27663094 GCTGGAGCACAGAGGGAGAGGGG - Intergenic
1124559889 15:30761740-30761762 GCAGCTGCACAGACAGAAAGGGG - Intronic
1124671355 15:31643978-31644000 GCAGCTGCACAGACAGAAAGGGG + Intronic
1124971184 15:34490700-34490722 GCTGGAGCAGAGGCAGCAGCGGG - Intergenic
1125292852 15:38168793-38168815 CCTGGAGAAGAGAAAGAAGGTGG - Intergenic
1125530070 15:40407272-40407294 GCTGGAGCACAGAGGGTGGGAGG + Intronic
1125582761 15:40798566-40798588 GCTGGAGCACAGTCAGCAAAGGG + Intronic
1126185608 15:45828582-45828604 GAGGGAGCACAGAGAGGAGGTGG + Intergenic
1126544283 15:49855536-49855558 ACTGGAGCAGAGACAGAAAGGGG + Intergenic
1127043732 15:55004268-55004290 GCAGAAGCACACACAGAAAGCGG + Intergenic
1127842388 15:62842581-62842603 GATGGGGCACAGGCAGAAGAGGG - Exonic
1128310773 15:66630713-66630735 GCTGGAGGCCAGTGAGAAGGTGG + Intronic
1129521501 15:76189330-76189352 GAGGGAGCAGAGAAAGAAGGAGG + Intronic
1130024864 15:80262231-80262253 GCTGGAGCACGGCAAGAAGGGGG + Intergenic
1130452311 15:84068072-84068094 GCTGGAGCAGAGAAAGCAAGAGG - Intergenic
1131340889 15:91599537-91599559 TCTGGAGAGCAGACGGAAGGTGG + Intergenic
1132336781 15:101052943-101052965 GCTGGAGCACAGCGAGGACGAGG + Exonic
1132878557 16:2150864-2150886 GCAGGAGCTCAGGCTGAAGGAGG + Intronic
1133118207 16:3590298-3590320 GCTGGAGTGCAGAAATAAGGGGG - Exonic
1133319512 16:4904262-4904284 GCTGGAGGACAGGCTGGAGGGGG - Intronic
1134075799 16:11290487-11290509 GCTGGAGCAGAGAGAGGTGGGGG + Intronic
1134099304 16:11440430-11440452 GCTGGGGCACAGCCACAAGGTGG + Intronic
1134365192 16:13570698-13570720 GCTGGAGCACAGGTTGCAGGGGG + Intergenic
1134995604 16:18736161-18736183 TCTGGAGCACAGCATGAAGGAGG - Intergenic
1135433592 16:22408790-22408812 GCTGGAGCAAAGTAAGCAGGAGG + Intronic
1135775475 16:25254189-25254211 CCAAGATCACAGACAGAAGGTGG + Intronic
1135852507 16:25977342-25977364 ACTGGAGCAGAGAATGAAGGTGG - Intronic
1136086757 16:27890751-27890773 GCTGGAGCTCAGACAGGTGGGGG + Intronic
1136280238 16:29204073-29204095 GCAGGAGCACAGGCTGGAGGAGG + Intergenic
1136787940 16:32946580-32946602 GCAGCTGCACAGACAGGAGGTGG - Intergenic
1136881841 16:33907209-33907231 GCAGCTGCACAGACAGGAGGTGG + Intergenic
1138695551 16:58809607-58809629 CCTGGAGAACAGATGGAAGGAGG - Intergenic
1139659861 16:68413277-68413299 CCTGGAGCAGAGGCAGAAGAAGG - Intronic
1140130620 16:72157539-72157561 GCTGGAGCAGAGACAGTAAGGGG + Intronic
1140620576 16:76726070-76726092 GCTGGACTACAGAGAGCAGGTGG - Intergenic
1141027079 16:80558858-80558880 GCAGGAGCAGATACAGAAGGAGG - Intergenic
1141606777 16:85158544-85158566 GGTGGAGAACAGACGGACGGGGG + Intergenic
1141762825 16:86039767-86039789 GCTGGAGCTCAGCCAGACTGAGG - Intergenic
1142067197 16:88069452-88069474 GAGGGAGCAGAGAGAGAAGGCGG - Intronic
1203090170 16_KI270728v1_random:1208237-1208259 GCAGCTGCACAGACAGGAGGTGG - Intergenic
1142597654 17:1037335-1037357 GCTGGAGGTCAGGCAGAGGGAGG - Intronic
1143023032 17:3926401-3926423 GCTGGAGGACAGACACAGGCTGG - Intronic
1143092536 17:4457595-4457617 GCTGGGGCCCAGGCAGATGGAGG + Intronic
1143363207 17:6388049-6388071 GGTGGAGCAGAGTGAGAAGGGGG + Intergenic
1143378223 17:6479685-6479707 GCTGGAGCACTCTCAGCAGGTGG + Intronic
1143632421 17:8146765-8146787 GCTGGGGCAAAGAGAGAAAGAGG + Exonic
1143731128 17:8883467-8883489 GCTGGAGCAGAGACAGCTGGTGG - Intronic
1144250311 17:13409647-13409669 ACTTGAGCAAAGACAGAAAGTGG - Intergenic
1144450815 17:15377013-15377035 ACTGGGGCTCAGAAAGAAGGAGG - Intergenic
1144675864 17:17161239-17161261 GCTGGAGCAGAGCCAGAAGGAGG + Exonic
1145878499 17:28337349-28337371 GCTGGTGCACAGACAGTAGGGGG - Intronic
1145959471 17:28879104-28879126 GCTCCATCACAGGCAGAAGGTGG - Intergenic
1147249399 17:39144082-39144104 CCTGGAGCCGAGACAGGAGGCGG + Intronic
1147716234 17:42510595-42510617 GCTGGAGCAGAGGCAGGAGTGGG + Intronic
1147920417 17:43913401-43913423 ATTGGAGCCCAGACAGAAGAGGG + Intergenic
1148139387 17:45317332-45317354 GCGGGCGGACTGACAGAAGGCGG + Intergenic
1148199996 17:45743895-45743917 CCTGGAGCCCAGACTGAGGGTGG + Intergenic
1148837247 17:50471839-50471861 GCTGTAGCACACACGGGAGGAGG - Intronic
1149574875 17:57704617-57704639 GCTGGAGCGCAGACAGGGGCTGG - Intergenic
1150069293 17:62138358-62138380 GCTGGCGCACTGCCAGAAGGTGG - Intergenic
1150251836 17:63709853-63709875 TCTGGGGCACAGAAAGAAGGAGG + Intronic
1150643580 17:66965000-66965022 GCTGGAGTACAGCCAGTAGTCGG - Exonic
1151297724 17:73197848-73197870 GCTTGAGCAGAGACTGGAGGTGG + Intronic
1151360324 17:73584783-73584805 GCAGGGACACAGGCAGAAGGGGG - Intronic
1151385111 17:73750433-73750455 ACTGCAGCACAAACAGAGGGAGG + Intergenic
1151416364 17:73968569-73968591 GCAGGAGCAGAGAGAGCAGGAGG + Intergenic
1151472727 17:74327917-74327939 GCTGGAGGACAGGCAGATGGGGG + Intronic
1151730719 17:75909646-75909668 GCTGGACCACAGCCAGGAGAAGG - Exonic
1151966792 17:77435735-77435757 GCTGCAGGACAGCCAGGAGGAGG - Intronic
1152076598 17:78163929-78163951 GCAGCAGCCCAGACACAAGGTGG + Intronic
1152822672 17:82445234-82445256 GCTGCCGCACAGACAGACAGAGG - Intronic
1153509852 18:5839555-5839577 AGTGGAGCACAGGCAAAAGGGGG + Intergenic
1153845977 18:9050248-9050270 ACTGGATAACAGACAGAAGTTGG + Intergenic
1154933375 18:21025138-21025160 GATAGAGAAAAGACAGAAGGTGG - Intronic
1156737353 18:40276470-40276492 GCTGGAGCTCAAAGACAAGGTGG + Intergenic
1157834202 18:50884022-50884044 GCTGGAGACAAGACAGAACGAGG - Intronic
1158889044 18:61856260-61856282 GCTGGAGAACAAACATAAGCTGG + Intronic
1160072874 18:75643587-75643609 GATGGAGCAGAGACTGAAGGAGG - Intergenic
1160201851 18:76802283-76802305 GCTGGAGCAGAGCCGGAGGGAGG + Intronic
1160726904 19:621393-621415 GCTGGCGCACTGCCAGAAGGTGG - Exonic
1161226156 19:3146916-3146938 GCTGGAGCAGAGTGAGGAGGGGG - Intronic
1161243055 19:3233657-3233679 GCTGGAGCAGAGTGAGGAGGGGG + Intronic
1161253092 19:3291729-3291751 GCTGGAGCAGAGTGAGGAGGGGG + Intronic
1161302979 19:3551837-3551859 GCTGGAGCAGAGAGAGAAGGGGG - Intronic
1161330237 19:3683424-3683446 GCTGGAGCGCAGGCAGGAGCTGG + Intronic
1161345957 19:3768821-3768843 GCTGGAGCAGAGTGAGGAGGGGG - Intergenic
1161357605 19:3827608-3827630 GCAGAAGCACAGAAAGAAGGAGG - Exonic
1161488308 19:4547813-4547835 GCTGGAGCACAGTGAGCAAGGGG - Intronic
1161515467 19:4693834-4693856 GCTGGAGCACAGGGAGGAGGGGG - Intronic
1161619214 19:5289592-5289614 GCTGGAGCAGAGGGAGGAGGGGG - Intronic
1161623203 19:5310062-5310084 GCTGGAGCAGAGTGAGGAGGGGG - Intronic
1161642948 19:5435713-5435735 GCTGGAGCAGAGTGAGGAGGGGG - Intergenic
1161741098 19:6021684-6021706 GCTGGAGCACAGTGAGGAGTGGG + Intronic
1161857045 19:6772140-6772162 GCTGGAGCACAGTGAAGAGGGGG + Intergenic
1162021939 19:7872102-7872124 GGTGGAGCAGAGGGAGAAGGAGG + Exonic
1162824169 19:13241366-13241388 GCGGGAGGACAGACAGACAGAGG + Intronic
1163404458 19:17113569-17113591 GGTGGTGCAAGGACAGAAGGAGG + Intronic
1164586911 19:29481427-29481449 GCTGGGCCACAGACACAAGGAGG + Intergenic
1165661924 19:37588550-37588572 ACTAGAGCACGGAGAGAAGGAGG + Intronic
1165850915 19:38849900-38849922 GCTGGAGCAGAGGCAGCAGCCGG - Exonic
1166003010 19:39889484-39889506 GCTGGAGCAGAGACAGTGGAAGG - Exonic
1166005797 19:39905736-39905758 GCTGGAGCAGAGACAGTGGAAGG - Exonic
1166098672 19:40557501-40557523 GCAGTGGCACAGACAGAAAGCGG + Intronic
1167237472 19:48323622-48323644 GCTGGAGCACAGGGAGACAGAGG - Intronic
1167859846 19:52273789-52273811 GGTAGAGCAGAGCCAGAAGGTGG + Intronic
924976193 2:177907-177929 GCTGGAGAGCAGAGTGAAGGAGG + Intergenic
925900210 2:8503878-8503900 GCTGGTGCCCAGACTGAGGGTGG - Intergenic
926244749 2:11114236-11114258 GCTGGAGCACAGGGAGAGGAAGG + Intergenic
926537063 2:14125934-14125956 GCTGGAGGTCAGAGAGAGGGGGG + Intergenic
926548018 2:14266227-14266249 GCTGGAGCAGAGAGATAAGAGGG + Intergenic
926811425 2:16758231-16758253 TGTGGAGGACAGGCAGAAGGTGG + Intergenic
927038272 2:19203254-19203276 TCAGGAGCACAGAAAGGAGGGGG + Intergenic
927247470 2:20969003-20969025 GAAGGACCAGAGACAGAAGGAGG - Intergenic
927456237 2:23251580-23251602 GCAGGAGCTCAGAAAGATGGTGG + Intergenic
927928685 2:27030275-27030297 GCTGGAGGACAGGTAGAAGGAGG + Intergenic
928074456 2:28250279-28250301 GCTGGAGCACAGTGAGTAAGGGG + Intronic
928439810 2:31283069-31283091 GCTGGAGGACAGACAGCTGAAGG - Intergenic
929080884 2:38121097-38121119 GCTGGAGCACCCACTGCAGGAGG - Intergenic
929489992 2:42387646-42387668 GCTGGGCCCCAGAAAGAAGGTGG - Intronic
930121636 2:47765562-47765584 GCTGAAGCTCAGAAAAAAGGAGG + Intronic
932508491 2:72260970-72260992 TCTGAAGAACAGACAGAGGGAGG - Intronic
932555381 2:72819496-72819518 GGTGGAGCAGAGAAAGGAGGAGG - Intronic
932804210 2:74768918-74768940 TCTGCAGCACAGTCAGAAGTTGG - Intergenic
932808156 2:74800396-74800418 GCTGGAGCACAGTGAGTAAGTGG + Intergenic
933862163 2:86480561-86480583 TCTGTAACACAGCCAGAAGGTGG - Intronic
934079869 2:88458682-88458704 GCTGGGGCAAAAGCAGAAGGAGG - Intergenic
934901946 2:98166488-98166510 TGTGCAGCACAGAGAGAAGGTGG + Intronic
935111971 2:100103521-100103543 GGGGGAGCAGAGAAAGAAGGGGG + Intronic
935558632 2:104538156-104538178 GCTGCAGCGCAGGCAGGAGGAGG + Intergenic
935616339 2:105086817-105086839 GCTGGACCACAGGCAGACTGTGG - Intronic
935673572 2:105575762-105575784 GCTGAAGCTCACACAGAAAGTGG - Intergenic
935934952 2:108171732-108171754 GGTGGAGCAGAGACAGAGAGAGG + Intergenic
936123000 2:109761629-109761651 GGGGGAGCAGAGAAAGAAGGGGG - Intergenic
936221686 2:110609835-110609857 GGGGGAGCAGAGAAAGAAGGGGG + Intergenic
936342162 2:111643266-111643288 GCGGAAGCACAGCCAGAAGAGGG + Intergenic
936685343 2:114821036-114821058 CCTGGTACACAGACAGAGGGAGG + Intronic
937421541 2:121760391-121760413 GCTGAAGCACAGAGAGAGGTAGG + Intronic
937525592 2:122765075-122765097 GCAGCAGCACAGACAGACAGTGG - Intergenic
937710358 2:124973934-124973956 GCTGATTGACAGACAGAAGGAGG + Intergenic
938239633 2:129733331-129733353 GAAGGAGCACAAACAGGAGGAGG - Intergenic
941917585 2:170822554-170822576 GCTGGAGAGCAGACCAAAGGCGG + Intronic
942988477 2:182170510-182170532 GTAGGAGTACAGACAGAAAGAGG - Intronic
943216611 2:185044830-185044852 CCTGGCCCACAGAGAGAAGGAGG - Intergenic
943721424 2:191206939-191206961 GCTGCAGCACAGACAGGAGGTGG - Intergenic
944114662 2:196173233-196173255 GCTGGAGCTAAGGCAGAAGCAGG - Intronic
945684499 2:212952814-212952836 GATGGAGCACACAGAGAAGGGGG + Intergenic
946000437 2:216477623-216477645 GCTGGACCACAGGGAGAAAGTGG + Intronic
946143969 2:217714647-217714669 GCTGGAGCCAAGACAGGAAGTGG - Intronic
947489277 2:230579829-230579851 TCTGTAGCACACACAGAAGGGGG - Intergenic
947950626 2:234143930-234143952 GCTGGGGCACAGACACCTGGAGG + Intergenic
948030935 2:234816822-234816844 GGTGGGGCACAGACCCAAGGAGG + Intergenic
948163013 2:235840587-235840609 GCAGGAGCCCAGGCAGGAGGTGG + Intronic
948369959 2:237482603-237482625 GCTGGAGCCCAGAGAGCAAGCGG + Intergenic
948652923 2:239459773-239459795 GCGGAAGCAGAGACAGAAGGTGG + Intergenic
1168902102 20:1373753-1373775 GCTGGAGCAGTCACAGAAGATGG + Intronic
1169804067 20:9541510-9541532 GCTGGAGTAAAGTCAGAAAGGGG - Intronic
1169967656 20:11235640-11235662 GCTGGAGCAGAGAGAGCAAGAGG + Intergenic
1171464098 20:25315828-25315850 GCAGGGGCACAGACAGAGGCGGG - Intronic
1173225021 20:41157509-41157531 GCAGGTACACAGGCAGAAGGAGG - Intronic
1173684078 20:44910381-44910403 GCAGGCGGACAGACAGAAGCCGG + Intronic
1174387841 20:50197809-50197831 GCTGGAGCAGAGGCAGCAAGGGG + Intergenic
1174400630 20:50273949-50273971 GCTGGAGCAGAGGCAGAATTAGG - Intergenic
1174436534 20:50510805-50510827 GCTGGAGAACAGAAGGGAGGTGG - Intronic
1174574494 20:51526865-51526887 GCTGGAGTTCAGAGAGAGGGAGG - Intronic
1175392497 20:58636073-58636095 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175392534 20:58636193-58636215 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175429085 20:58890132-58890154 GCTGGAGCAGAGGCGAAAGGAGG + Intronic
1175856565 20:62123501-62123523 GCTGGAGGACTTACAGGAGGGGG + Intronic
1177728268 21:24995288-24995310 GCTGGGGCACAGAAGGAGGGGGG + Intergenic
1178121922 21:29477893-29477915 GTTGGAGCACAGACAGCTAGAGG + Intronic
1178177460 21:30119301-30119323 GCTGAAGCACAGACATGAGGTGG - Intergenic
1178285341 21:31321124-31321146 CCTGGGCCACAGAAAGAAGGGGG + Intronic
1178607893 21:34055405-34055427 GCTGGAAACCAGACAGTAGGAGG + Intergenic
1178752692 21:35319557-35319579 GCTGGAGCAGAATCAGCAGGTGG + Intronic
1179614795 21:42575475-42575497 GCAGGAGCCCAGAGAAAAGGGGG - Intronic
1179902951 21:44403203-44403225 CCTGGATCACAGACAGATGCAGG - Intronic
1181006211 22:20014894-20014916 TGTGTAGCACAAACAGAAGGAGG + Intronic
1182598762 22:31443236-31443258 GCTGGAGGAAAAACAGAATGGGG + Intronic
1182625080 22:31639780-31639802 GAGTGAGCACAGACAGAGGGTGG - Intronic
1182646617 22:31815221-31815243 GCTGAAGCACAGACAGAGCCAGG + Intronic
1183382295 22:37496284-37496306 GCACAAGGACAGACAGAAGGAGG + Intronic
1183505940 22:38208921-38208943 GCTGGAGCACAGAGTGGAGGTGG + Intronic
1184112296 22:42402444-42402466 GCAGGAGCACACACAGAGCGCGG + Intronic
1184379224 22:44134645-44134667 GCTGCAGAGAAGACAGAAGGCGG - Intronic
1184546181 22:45170064-45170086 GCTGAAGCAGAGAAGGAAGGCGG - Intronic
1184738406 22:46412438-46412460 CCTGGAGTACAGACACCAGGAGG + Intronic
1184842909 22:47063103-47063125 GGTGGAGGATGGACAGAAGGAGG + Intronic
1184856393 22:47148872-47148894 GCGGGAGCACAGCCAGGAGGTGG - Intronic
1185048233 22:48539892-48539914 GCAGGGGTACAGGCAGAAGGTGG + Intronic
1185280059 22:49966169-49966191 GCAGGAGCCCAGACAGCTGGGGG - Intergenic
1185294883 22:50048247-50048269 CCTGGAGGACAGACAGAAGCAGG - Intronic
950486058 3:13274551-13274573 GCTGGGGCAAAGCCAGAAGAGGG + Intergenic
950566187 3:13771039-13771061 GCTGGAGCAGAGTGAGCAGGAGG - Intergenic
951181415 3:19663557-19663579 GCTCGACCACACACAAAAGGGGG - Intergenic
951583898 3:24195707-24195729 GCTGGAGGATAGAGAGAAGGGGG - Intronic
953169729 3:40496246-40496268 GATGGAGCACAGACTGGAGATGG + Intergenic
953605626 3:44411439-44411461 GCTGGAGCAGAGGGAGAATGGGG - Intergenic
953626843 3:44578967-44578989 GCTGGAGCAGAGCCAGAAGGAGG - Intronic
953773190 3:45794412-45794434 GTGGGTGCACAGACAAAAGGAGG - Intronic
953860456 3:46540016-46540038 GCTGGAGCACAGGGTGGAGGTGG + Intronic
954384327 3:50236404-50236426 GCGGGAGGACGGAGAGAAGGCGG + Exonic
954449497 3:50564000-50564022 GGTGCAGCACAGGCAGAATGAGG - Intronic
954581600 3:51706242-51706264 GCTGGAGCCCAAGCAGAGGGAGG - Intergenic
956274555 3:67484050-67484072 GCCAGAGCACACACAGAGGGAGG - Intronic
957971416 3:87387871-87387893 GCTGGAGCAAAGTCATAAGAAGG + Intergenic
958630097 3:96673209-96673231 GATGGAGGACAGAGAGATGGAGG - Intergenic
958630111 3:96673323-96673345 GATGGAGGACAGAGAGATGGAGG - Intergenic
958737056 3:98021350-98021372 GCTGAGTCACAGATAGAAGGTGG + Intronic
960941986 3:122940869-122940891 GCTGGGGCACAGCCATAAGCTGG - Intronic
961744665 3:129056807-129056829 GCAAAAGCACAGACAGAAGTTGG + Intergenic
962835670 3:139186362-139186384 CCTGAGGCACAGACAGGAGGGGG - Intronic
962973881 3:140429428-140429450 GCTTTAGCACAGAGAGGAGGGGG + Intronic
963129526 3:141845605-141845627 GCAGAAGCGCAGACAGCAGGGGG - Intergenic
963811162 3:149777713-149777735 GCTGGAGCACACACAGATGTGGG - Intronic
964348518 3:155779627-155779649 ACTGGAGCAAAGCCAGAAGAAGG + Intronic
966597246 3:181735676-181735698 GCTGGAGAACAGACAGAGGCGGG + Intergenic
966954697 3:184863583-184863605 GCAGGAGCCTAGAGAGAAGGAGG + Intronic
967054400 3:185816309-185816331 GCTTGCCCACAGACAGAAGTGGG - Intronic
967054980 3:185823887-185823909 GCTGGAGCCCAGACAGGAGACGG - Intronic
967135522 3:186509711-186509733 GCTGAATCACAGACAGAGGCTGG - Intergenic
967316373 3:188154638-188154660 GCTGAGGCCCAGAGAGAAGGAGG + Intronic
967976185 3:195035880-195035902 GGTGGGGCACAGCCTGAAGGAGG + Intergenic
968372701 4:10733-10755 GCAGGCGCACAGACGGATGGTGG + Intergenic
969192473 4:5533391-5533413 GCTGGAGCAGAGCCAGTGGGGGG + Intergenic
969199589 4:5592265-5592287 GCTGGCTCCCAGAGAGAAGGGGG + Intronic
971249426 4:24961165-24961187 GCTGAAGGACAGAAAGAAGAAGG + Intronic
971470847 4:27024928-27024950 GCTGGAGCACGGAGTGAAGATGG + Intronic
972236342 4:37138171-37138193 GCTGGAACACAGTCACCAGGAGG + Intergenic
972814405 4:42628399-42628421 GCTGGAGCACAGACAGAAGGCGG + Intronic
973187611 4:47349132-47349154 TCTGGAGCACAGAGGGAGGGAGG + Intronic
974074652 4:57157509-57157531 GATGGAGAACAGAAAGAAGGTGG - Intergenic
975191975 4:71474981-71475003 CCTGAAGCACTGACTGAAGGGGG - Intronic
975855973 4:78624793-78624815 GCTGGAGCACAGTGAGGAAGAGG - Intergenic
976855536 4:89600528-89600550 GCTGGAGAAAAGACAGAAAGAGG + Intergenic
977211820 4:94227084-94227106 GCTGGAGCAAAGACATAAAGGGG + Intronic
977993214 4:103469878-103469900 GATGGAACACAGAGATAAGGTGG + Intergenic
978818793 4:112939714-112939736 GCTGGAAGACAGATATAAGGAGG - Intronic
979824339 4:125215018-125215040 GGTGAAGCACAGACAGCAGCTGG + Intergenic
981049396 4:140295581-140295603 GCCGGAGCCCAGCCAGCAGGCGG - Intronic
982521094 4:156417515-156417537 ACTGGAGAACAGACAGAGGTTGG - Intergenic
985471270 5:48384-48406 GCTGGAGAGCAGAATGAAGGCGG + Intergenic
985471312 5:48613-48635 CCTGGGGCACAGAGTGAAGGAGG + Intergenic
985628416 5:1002182-1002204 GCTGCAGCTCAGGCAGAAGCAGG + Intergenic
985633633 5:1025776-1025798 GCTGGGGCACCCACAGAGGGTGG - Intronic
985633722 5:1026106-1026128 GCTGGGGCACCCACAGAGGGTGG - Intronic
988366681 5:30309647-30309669 GCTGGTTAACAGACAGAGGGTGG + Intergenic
989652138 5:43702884-43702906 GCCGGAGAACAGACAGAAGCTGG - Intronic
990498887 5:56375201-56375223 AATGGGGCACAGACAGCAGGTGG + Intergenic
994127929 5:96190487-96190509 GCTGCAGCAGAGACAGCAGAAGG - Intergenic
994457127 5:100025139-100025161 TCTTAAGCAGAGACAGAAGGGGG + Intergenic
997660268 5:135583827-135583849 GCAGGTGAACAGACAGAGGGAGG - Intergenic
997709449 5:135991317-135991339 ACTGTGGCACACACAGAAGGTGG - Intergenic
998533073 5:142903042-142903064 GCTAGAGGAAAGGCAGAAGGGGG - Intronic
998621056 5:143794526-143794548 GCTGGAGCACAGAAAACAGAGGG + Intergenic
999057686 5:148597531-148597553 GCTGGAACACAGACAGTAAAGGG - Intronic
999687788 5:154117972-154117994 GCTGGAGCACAGAGAGGAGGTGG - Intronic
1000641590 5:163709356-163709378 GCTGGAGGAGAAACTGAAGGAGG - Intergenic
1001241949 5:170077895-170077917 GCCGGAGAAGAGAGAGAAGGAGG - Intronic
1002435413 5:179228138-179228160 TCTGGAGCACAGAGAGAGGGTGG + Intronic
1002695788 5:181087449-181087471 GCAGGAGCAGGGACAGCAGGAGG + Intergenic
1002724567 5:181286152-181286174 GGCTGAGCACAGACAGAAGAGGG - Intergenic
1003013834 6:2452004-2452026 GCTGGAGCACGGGCAGGAGGAGG + Intergenic
1003363048 6:5446881-5446903 GCTGGTGCAGAGACACAGGGAGG + Intronic
1005083451 6:21980574-21980596 GCTGCAGAACAGGAAGAAGGAGG - Intergenic
1005948438 6:30612990-30613012 ACTGCAGAACATACAGAAGGTGG + Intronic
1006310276 6:33252764-33252786 AATGTAGCACAGACAGAAGATGG + Intronic
1006371926 6:33650150-33650172 GCTGAAGGGCAGAGAGAAGGAGG - Intronic
1006418860 6:33921045-33921067 GCTGGAGTGCAGACAGAGGCAGG + Intergenic
1007309568 6:40934727-40934749 GCTGCAGCACAGACACAGGTGGG + Intergenic
1007654105 6:43441871-43441893 GCTGGAGACCAGACAGAGGTGGG + Exonic
1007933257 6:45711148-45711170 GCTGGAGCTCTGATAGAGGGCGG - Intergenic
1008535399 6:52503309-52503331 GCTGGAGCTAAGGCAGAAGAGGG + Intronic
1009456600 6:63864141-63864163 CATGGAGCACAGACAGAAAGAGG - Intronic
1010084933 6:71905994-71906016 ACTGGAGTACAGGCATAAGGAGG - Intronic
1011767888 6:90643552-90643574 GCTGTGGCAGACACAGAAGGTGG - Intergenic
1012212632 6:96540905-96540927 GCTGGAACATAGACAGAGGATGG - Intronic
1012374257 6:98541928-98541950 TCTAGAGCACAAACAGAATGTGG + Intergenic
1012906523 6:105073123-105073145 GCTGGATCACAGCCAGCTGGTGG - Intronic
1013343221 6:109235855-109235877 GTTGGGGCACAGACACGAGGTGG + Intergenic
1013597108 6:111670219-111670241 GCTGGAGCAGAGGGAGCAGGAGG - Intronic
1014098049 6:117481873-117481895 GCTGGAGCACAGTGAACAGGTGG - Intronic
1015734972 6:136389410-136389432 GGAGGAGCAGAGGCAGAAGGAGG - Exonic
1016904020 6:149131447-149131469 CCTGGACCACACACTGAAGGTGG + Intergenic
1016928844 6:149382137-149382159 GCTGGAACACAGTGAGCAGGTGG - Intronic
1017238450 6:152141260-152141282 ACTGGAGCACAAACTGAAGGAGG - Exonic
1017638314 6:156465442-156465464 GCTGGAGCAGAGTCAGCAGCGGG + Intergenic
1019175563 6:170157664-170157686 GCTGGGTCACAGAGAGATGGCGG + Intergenic
1019175571 6:170157704-170157726 GCTGGGTCACAGAGAGATGGCGG + Intergenic
1019175580 6:170157745-170157767 GCTGGGTCACAGAGAGACGGCGG + Intergenic
1019175588 6:170157786-170157808 GCTGGGTCACAGAGAGATGGCGG + Intergenic
1019175608 6:170157869-170157891 GCTGGGTCACAGAGAGATGGTGG + Intergenic
1019175645 6:170158077-170158099 GCTGGGTCACAGAGAGATGGCGG + Intergenic
1019175671 6:170158202-170158224 GCTGGGTCACAGAGAGATGGTGG + Intergenic
1019847611 7:3521942-3521964 TCTGCAGGACAGAGAGAAGGTGG + Intronic
1020024036 7:4885982-4886004 GTGGGGGCACAGCCAGAAGGTGG - Intergenic
1020046874 7:5046660-5046682 TCTGGAGCACGGAAAGGAGGAGG - Intronic
1020292234 7:6730540-6730562 TCTGGAGCACGGAAAGGAGGAGG - Intergenic
1020373211 7:7457251-7457273 TATGGAGAACAGACTGAAGGGGG + Intronic
1023212932 7:37827739-37827761 GCTGGAGCCCAGGGATAAGGAGG - Intronic
1023294942 7:38704930-38704952 GGAGGAGCACAGACAGAATGTGG + Intergenic
1023693428 7:42818604-42818626 GGTGGAGCACAGAAAGAAGAAGG + Intergenic
1025607376 7:63048987-63049009 GCAGGGGGACAGAGAGAAGGAGG - Intergenic
1026473132 7:70711224-70711246 CCTGGAGCTAATACAGAAGGTGG - Intronic
1026727417 7:72880149-72880171 TCTGGAGCACAGAGAGGAGGAGG - Intronic
1026946743 7:74321018-74321040 GCTGGATCACAGCCAGAATTTGG - Intronic
1027116432 7:75485578-75485600 TCTGGAGCACGGAGAGGAGGAGG + Intronic
1027121719 7:75527278-75527300 TCTGGAGCACGGAGAGGAGGAGG + Intergenic
1027275394 7:76550125-76550147 TCTGGAGCACGGAGAGGAGGAGG - Intergenic
1029575612 7:101401515-101401537 GCAGGAGGACAAAGAGAAGGAGG + Intronic
1029721104 7:102364675-102364697 TCTGGAGCACGGAGAGGAGGAGG - Intronic
1029906498 7:104098626-104098648 GATGGAGCACAGGAAGCAGGTGG + Intergenic
1029950962 7:104585150-104585172 GCTAGAGGGCAGACAGTAGGAGG - Intronic
1030820044 7:114084272-114084294 GTGGGAGCAGAGACAGAAGGAGG - Intergenic
1031111628 7:117617674-117617696 GCAAGAACACAGGCAGAAGGTGG - Intronic
1031528847 7:122852687-122852709 GCTGGAGCAGAGAGAGCAAGGGG + Intronic
1031597268 7:123662666-123662688 GCAGGAGCAAAAACAGCAGGAGG + Exonic
1032218221 7:129973835-129973857 GCTGGAGCACAATCAGAGTGTGG + Intergenic
1033942878 7:146677589-146677611 GCTAGAGGACAGAGAGAGGGAGG - Intronic
1035237601 7:157508949-157508971 GCTGGGGGACACACAGGAGGAGG + Intergenic
1035719311 8:1779731-1779753 GCTAGGACACAGCCAGAAGGTGG - Intronic
1036178723 8:6565112-6565134 GCTGGAGGTCACACAGAAGCAGG - Intronic
1036184206 8:6610246-6610268 GCTGGGATGCAGACAGAAGGCGG + Intronic
1037140515 8:15513879-15513901 GATGGAGGACAGACTAAAGGTGG - Intronic
1037503925 8:19511876-19511898 GCAGCAGAAGAGACAGAAGGGGG + Intronic
1038131996 8:24742931-24742953 GCGGGAGCACAGAGAGTATGAGG + Intergenic
1038160645 8:25034016-25034038 GCTGGAGCACAGAGAAAAGAGGG + Intergenic
1038682982 8:29687317-29687339 GTTGCAGGACAGATAGAAGGGGG + Intergenic
1039567770 8:38563732-38563754 GCTGGAGCTCAGAAAGAAAAGGG - Intergenic
1039569131 8:38573011-38573033 GCAGAAGCACTGACAGAAAGGGG + Intergenic
1039616949 8:38962981-38963003 GGTGGAGAACAGAATGAAGGAGG + Intronic
1039809146 8:41028973-41028995 GCTGGAGCACAGAGTGAGAGAGG - Intergenic
1040866591 8:52054209-52054231 GCTGGAGCACAGGCAGTGTGGGG - Intergenic
1042701866 8:71624412-71624434 GAAGGAGCAAAGACAGAAGAGGG - Intergenic
1042748757 8:72135439-72135461 GCGGGCGCAGACACAGAAGGGGG - Intergenic
1043413999 8:80030032-80030054 GGTGGAGCCCCTACAGAAGGTGG - Exonic
1043879163 8:85522187-85522209 ACTGGAGCACAGACAGTTAGGGG - Intergenic
1045675009 8:104597850-104597872 GGTGGAGAGCAGTCAGAAGGGGG + Intronic
1047337914 8:123953920-123953942 TCTGGAGAACATACACAAGGAGG - Intronic
1048293710 8:133199176-133199198 TCTGGAGCAAGGACAGAACGAGG + Intronic
1048795047 8:138141834-138141856 GCTGGAGCAGAGCCTGCAGGAGG - Intronic
1048908963 8:139115991-139116013 GATGGAGTTCAGACACAAGGTGG + Intergenic
1048922791 8:139246154-139246176 GCTGGGGCACAGACAAATGAGGG + Intergenic
1049579034 8:143402603-143402625 GGAGAAGCACAGAGAGAAGGCGG - Intergenic
1051406524 9:16743574-16743596 GCTGGAGCACACACAGCTGTGGG - Intronic
1052227066 9:26102690-26102712 GCTGGAGCACAAACAAAGAGGGG + Intronic
1052435615 9:28424362-28424384 GCTGGAGAATAGACAAAATGTGG + Intronic
1052902416 9:33804808-33804830 GCTGAAGAACAGAGAGAAAGTGG - Intergenic
1053380898 9:37649472-37649494 GCTGGGGCACTGACAGAAAAGGG + Intronic
1053511452 9:38691219-38691241 GAGGGAGCAGAGAGAGAAGGAGG + Intergenic
1053576867 9:39362938-39362960 GCTGGAGCAGAGACAGACCCTGG - Intergenic
1053621889 9:39828044-39828066 ACTGGAACAGAGAGAGAAGGGGG - Intergenic
1053837822 9:42159902-42159924 ACTGGAACAGAGAGAGAAGGGGG - Intergenic
1053841380 9:42190863-42190885 GCTGGAGCAGAGACAGACCCTGG - Intergenic
1053883196 9:42616228-42616250 ACTGGAACAGAGAGAGAAGGGGG + Intergenic
1053889473 9:42678071-42678093 ACTGGAACAGAGAGAGAAGGGGG - Intergenic
1054098437 9:60921629-60921651 GCTGGAGCAGAGACAGACCCTGG - Intergenic
1054119838 9:61197259-61197281 GCTGGAGCAGAGACAGACCCTGG - Intergenic
1054222220 9:62423701-62423723 ACTGGAACAGAGAGAGAAGGGGG + Intergenic
1054228493 9:62485471-62485493 ACTGGAACAGAGAGAGAAGGGGG - Intergenic
1054587916 9:66985303-66985325 GCTGGAGCAGAGACAGACCCTGG + Intergenic
1054754935 9:68948070-68948092 TCTGGAGCAAACACAGAATGAGG + Intronic
1054962102 9:70980346-70980368 GCATGATCACAGTCAGAAGGGGG + Intronic
1056126847 9:83543244-83543266 GCTAGGGCACAGAAAAAAGGAGG + Intergenic
1056720273 9:89065209-89065231 GCAGGAGGACAGGCAGCAGGTGG + Intronic
1058504621 9:105655596-105655618 GTTGGAGAACAGACAGAAGGAGG + Intergenic
1058528201 9:105881028-105881050 GCTGGAACACTGAGAGAAGGTGG + Intergenic
1059447680 9:114348978-114349000 GCTGGGGCACAGCCAGGAAGAGG - Intronic
1059506446 9:114803709-114803731 GCAAGAGCACAGAAGGAAGGAGG - Intronic
1059919397 9:119141088-119141110 GCTGGAGCACAGACAAAGGTAGG + Intergenic
1060464126 9:123887484-123887506 GTTGAAGCACAGGCAGAATGAGG + Intronic
1061274611 9:129562216-129562238 GCTGGAGGACAGAGAGAATGGGG - Intergenic
1061868514 9:133507625-133507647 GATGGTGCACAGACTGATGGGGG - Intergenic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1061926055 9:133806557-133806579 GGAGGAGCACAGACAGAAAGAGG - Intronic
1061957174 9:133969798-133969820 GCTGGGGCAGAGGCAGATGGGGG - Intronic
1062070333 9:134552027-134552049 GATGGAGCAGAGTCAGCAGGAGG - Intergenic
1062170804 9:135133640-135133662 GCTGGAGGGCACTCAGAAGGTGG + Intergenic
1062469466 9:136696250-136696272 GCTGTGGCACAGACAGCAGCTGG - Intergenic
1062716054 9:138010741-138010763 GATGGTGCACAGGCAGAAGAGGG - Intronic
1186356097 X:8792173-8792195 GCAGGAGCAAAGACAGAGGGCGG + Intronic
1186377848 X:9026373-9026395 GTGGGAGGAAAGACAGAAGGCGG + Intronic
1188402539 X:29764593-29764615 GCTGGAGGACATAAAAAAGGAGG + Intronic
1188930745 X:36108223-36108245 TTTGGAGCAAAGACAGAAGAAGG - Intronic
1189292416 X:39895655-39895677 GGTGGAGCCCAAAGAGAAGGAGG + Intergenic
1189326740 X:40116895-40116917 GATGATCCACAGACAGAAGGTGG + Intronic
1192449355 X:71233832-71233854 GCTGGAGCAGAAACAGAAAGGGG - Intergenic
1193397789 X:81005722-81005744 ACTGAAGCACAGAAAGAGGGTGG - Intergenic
1195861823 X:109391271-109391293 GCTGGAGGAGTGAGAGAAGGTGG + Intronic
1196764975 X:119235390-119235412 GCTGGAGCCCAGACAAAGGCGGG - Intergenic
1197780420 X:130153654-130153676 GCTGGAGCTCATACAGGAAGGGG + Intronic
1198509875 X:137339759-137339781 GAAGGAGAACAGACAGTAGGAGG + Intergenic
1199909445 X:152270518-152270540 ACTGGATAACAGGCAGAAGGTGG + Intronic
1200363024 X:155631091-155631113 ACTGGAGCAGGGAGAGAAGGAGG - Intronic
1200933217 Y:8715763-8715785 GCTGGAGAGCAGACAGGAGGGGG - Intergenic
1202247704 Y:22836624-22836646 TCTGGAGCTCTGGCAGAAGGAGG - Intergenic
1202400692 Y:24470372-24470394 TCTGGAGCTCTGGCAGAAGGAGG - Intergenic
1202470088 Y:25199714-25199736 TCTGGAGCTCTGGCAGAAGGAGG + Intergenic