ID: 972814991

View in Genome Browser
Species Human (GRCh38)
Location 4:42634717-42634739
Sequence TTGCATATGCATGAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972814991_972814995 26 Left 972814991 4:42634717-42634739 CCTGGCTCCTCATGCATATGCAA 0: 1
1: 0
2: 1
3: 12
4: 126
Right 972814995 4:42634766-42634788 AAATCAGAAAGGCATACTATGGG 0: 1
1: 0
2: 2
3: 18
4: 252
972814991_972814993 15 Left 972814991 4:42634717-42634739 CCTGGCTCCTCATGCATATGCAA 0: 1
1: 0
2: 1
3: 12
4: 126
Right 972814993 4:42634755-42634777 TTTTTATTATGAAATCAGAAAGG 0: 1
1: 0
2: 6
3: 68
4: 825
972814991_972814994 25 Left 972814991 4:42634717-42634739 CCTGGCTCCTCATGCATATGCAA 0: 1
1: 0
2: 1
3: 12
4: 126
Right 972814994 4:42634765-42634787 GAAATCAGAAAGGCATACTATGG 0: 1
1: 0
2: 2
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972814991 Original CRISPR TTGCATATGCATGAGGAGCC AGG (reversed) Intronic
903027516 1:20440110-20440132 TTACATATGCATGTGGACACTGG + Intergenic
903763233 1:25713870-25713892 TTGCAAGTGCATGAGGAACCTGG - Intronic
908120487 1:60981615-60981637 TTGAATATGCATTATGTGCCAGG - Intronic
909566010 1:77054331-77054353 TGGCATAGGGATAAGGAGCCAGG + Intronic
911788224 1:101978933-101978955 TAGCATATGCCTAAGGAGACAGG - Intronic
919329674 1:196155027-196155049 TTGAATATAAATGAGGAGACTGG + Intergenic
919675508 1:200378416-200378438 TAACATATTCATGAGGAGCAGGG + Intergenic
921077646 1:211712642-211712664 GGGCCTATGCATGAGGGGCCTGG - Intergenic
923147207 1:231206606-231206628 TTCCAAATGCTAGAGGAGCCTGG + Intronic
924756286 1:246944323-246944345 CTGCACATGCTTGAGAAGCCTGG + Intergenic
1071363317 10:84873409-84873431 GTGCACATGCAAGAGGAGCCAGG + Intergenic
1078290888 11:10008593-10008615 TTGCATTGGTATGAGAAGCCAGG + Intronic
1078771950 11:14359210-14359232 CTGCATATGCATGAGGGGGCGGG + Intronic
1083589833 11:63887155-63887177 TAGCTTATGGAGGAGGAGCCAGG + Intronic
1084472459 11:69371087-69371109 TTCCATGTGAGTGAGGAGCCGGG + Intergenic
1084783346 11:71425846-71425868 GTGCATTTGCATGAGCTGCCTGG + Intergenic
1090021928 11:123136350-123136372 TTTCATATTCTTGGGGAGCCGGG + Intronic
1090661964 11:128889123-128889145 TTATATTTGCATTAGGAGCCTGG - Intergenic
1092440717 12:8499521-8499543 TTGCAATTGCATGAGAATCCAGG + Intergenic
1092527758 12:9319597-9319619 TTGAATACTCATGAGGACCCAGG + Intergenic
1093744314 12:22722300-22722322 TTTCATATCCATGAAGTGCCTGG - Intergenic
1094318219 12:29155352-29155374 ATGCAAATGCATGGGGATCCAGG - Intronic
1101605114 12:106242473-106242495 TTGCTATTGGATGAGGAGCCTGG - Intronic
1102867703 12:116387096-116387118 TTGCATCTGCATTGGGAGCCTGG - Intergenic
1103556523 12:121770013-121770035 TTGCACTTGGACGAGGAGCCAGG + Intronic
1104351388 12:128047078-128047100 TTGCATAGGCATGAGTTGTCGGG + Intergenic
1104622892 12:130331624-130331646 GTGCGTATGCATGAGGAGGCGGG + Intergenic
1104873170 12:132015069-132015091 GTGCATGCGCATGTGGAGCCTGG + Intronic
1105429311 13:20322874-20322896 TTGCACTTACATGAGGTGCCTGG + Intergenic
1105809139 13:23979450-23979472 TTGCATATTCATAAGAAGGCGGG - Intergenic
1108974703 13:56424315-56424337 TTGGAAATGCAGGAGGAGCTGGG + Intergenic
1110632943 13:77730782-77730804 TTGCATATGCATGCTCAGTCTGG + Intronic
1111437876 13:88236017-88236039 TTGAATATGATTGATGAGCCGGG + Intergenic
1112018247 13:95349295-95349317 TGGGATATGCATGACCAGCCTGG - Intergenic
1120831427 14:89000832-89000854 TGGCATATGGCTGAGGAGGCTGG - Intergenic
1121569898 14:94939695-94939717 ATGCAGATGCATGACAAGCCTGG - Intergenic
1122420348 14:101572516-101572538 GTGCATATGGAGCAGGAGCCTGG - Intergenic
1122420371 14:101572672-101572694 GTGCATATGGAGCAGGAGCCGGG - Intergenic
1122975401 14:105168810-105168832 CTGCATATGCATGAGGGGGCGGG + Exonic
1124235717 15:27988053-27988075 GTGAATACGCATGAGGAGACAGG + Intronic
1128726236 15:69990614-69990636 CTGCCTGTGCATGAGGAGCTGGG + Intergenic
1132075089 15:98813263-98813285 TTGCATATGAGTGAGGGGCGTGG - Intronic
1133153246 16:3852895-3852917 TTGCACATACATGAATAGCCTGG - Intronic
1134842022 16:17409359-17409381 TGGCTTATGCATGAGGAGCCTGG - Intronic
1138237794 16:55399857-55399879 TTGCATAAGCATGTGATGCCTGG - Intronic
1139381096 16:66531505-66531527 TGGCATCTGCAGGAGGACCCTGG + Intronic
1141393247 16:83681845-83681867 TTGCATCTGTCTGAGAAGCCGGG - Intronic
1141628592 16:85274871-85274893 CTGCAGATGCATGTGGGGCCTGG + Intergenic
1143864309 17:9912716-9912738 TGGCATTTGGAGGAGGAGCCTGG + Intronic
1154411181 18:14143058-14143080 TTGCAGATGCCTCAGAAGCCAGG - Intergenic
1159625777 18:70692265-70692287 TTGCAAATGCAGGAGCAGCGTGG - Intergenic
1164988532 19:32667438-32667460 TGGCATATGCCTGTTGAGCCAGG - Intronic
1165231785 19:34391854-34391876 TGGCATAAGCATGAGGATCTGGG + Intronic
1166122648 19:40694645-40694667 TTGGATGTGCATGTGAAGCCTGG - Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
925716462 2:6788480-6788502 TTGTGTAGGCATTAGGAGCCTGG - Intergenic
926958306 2:18326774-18326796 CTGCATATGCCTGGGGAGCAAGG + Intronic
927046396 2:19283188-19283210 GTGCATAGGCATGAGGCGCAAGG - Intergenic
933588022 2:84200961-84200983 TTGCATTGGCTTTAGGAGCCTGG - Intergenic
934694123 2:96386311-96386333 TTGCCTATGTATGAGGAGAAGGG - Intergenic
937922877 2:127144342-127144364 TTTCCTCTGCATCAGGAGCCAGG - Intergenic
939133492 2:138266335-138266357 TTGCAATTCCATGAGAAGCCTGG + Intergenic
940672871 2:156692070-156692092 TTGCATATTCATTAAGAGCTAGG + Intergenic
948550593 2:238770164-238770186 CAGCATATGCATGAGAAGGCAGG - Intergenic
948919523 2:241055744-241055766 TTACAAATGCATGAGAAGCCAGG + Intronic
1172396460 20:34609658-34609680 TTAAATATGAAGGAGGAGCCAGG - Intronic
1177283145 21:19011469-19011491 TTGCATATCCATGATGAACCTGG - Intergenic
1180099126 21:45576171-45576193 CTGCAGATGCAGGAGGACCCTGG + Intergenic
1181731587 22:24850799-24850821 TTGCAAATGCATGGTGAGGCTGG + Intronic
1182129017 22:27837096-27837118 TTGCATATGCCTGTGGTCCCAGG + Intergenic
1184168027 22:42742196-42742218 TTGCCCAAGCTTGAGGAGCCAGG - Intergenic
1184760672 22:46542361-46542383 TTGCATCTCCCTGGGGAGCCCGG + Intergenic
949513830 3:4789381-4789403 TTCCATGTTCATGAGGATCCTGG - Intronic
951649655 3:24936950-24936972 TTAAATATCTATGAGGAGCCTGG + Intergenic
953072496 3:39535623-39535645 TTGCAAATGCAAGAGGAACAAGG - Intergenic
954127409 3:48539601-48539623 CTGCTTATGCATGAGGGGCATGG - Intronic
955074492 3:55600918-55600940 TGGCATCTGGATGAGGAGCTGGG + Intronic
957200178 3:77124411-77124433 TTACTGATTCATGAGGAGCCTGG + Intronic
962709875 3:138077354-138077376 GTGCAGATGCCAGAGGAGCCCGG + Intronic
963049422 3:141128504-141128526 TTGTATATGGCAGAGGAGCCAGG + Intronic
963585536 3:147182760-147182782 TTGGAAATGCCTGAGGAACCCGG - Intergenic
963610502 3:147461297-147461319 TTGCATGTGCATGAGGCACCAGG - Intronic
963765661 3:149333537-149333559 CTTCATATTCATGAGGAGACGGG + Exonic
965332629 3:167395494-167395516 TTGTTGCTGCATGAGGAGCCAGG - Intergenic
966476463 3:180353967-180353989 TTGCATATGGATGAAGAGATGGG - Intergenic
966945337 3:184773728-184773750 TTCCATATGCCTGAAGAGCGGGG - Intergenic
972789646 4:42358727-42358749 TTGCATGTCTATGAGGTGCCAGG - Intergenic
972814991 4:42634717-42634739 TTGCATATGCATGAGGAGCCAGG - Intronic
980474151 4:133289720-133289742 TTCCATATGCTTGAGGTGCAAGG - Intergenic
984644620 4:182206228-182206250 TAGCCTGGGCATGAGGAGCCAGG - Intronic
987046625 5:14115107-14115129 TAGCTTCTGCAGGAGGAGCCAGG + Intergenic
988217209 5:28290358-28290380 TTGCATGTGATTGAAGAGCCTGG - Intergenic
992063383 5:73080554-73080576 TTGCATATGCCTGAAGAGTCTGG + Intronic
993590443 5:89789206-89789228 TTGCATATGCAAGAGTTACCTGG - Intergenic
994700186 5:103123606-103123628 TTACAAATGGATGAGCAGCCAGG - Intronic
998988634 5:147790370-147790392 TTGCATTTGCCTAAGGATCCTGG - Intergenic
1000541296 5:162543262-162543284 TTGCATATGCATCTGGAGATGGG + Intergenic
1000767400 5:165309096-165309118 TTGCATTTGGATGAGGCCCCTGG - Intergenic
1001920662 5:175596879-175596901 TTTCAAATGAGTGAGGAGCCAGG - Intergenic
1002280542 5:178127499-178127521 CTGCCCAAGCATGAGGAGCCTGG - Intergenic
1002834607 6:855627-855649 TTGAATCTGCATGAGAACCCTGG - Intergenic
1006988754 6:38194834-38194856 TTGCTTCTGCATGGGGAGGCAGG + Intronic
1007263536 6:40580577-40580599 TTGTATATGGATGAGGAAACTGG - Intronic
1008172501 6:48226166-48226188 TTGCACATGCATGAGACACCAGG - Intergenic
1008744756 6:54656427-54656449 TTTAATATGCATGATGGGCCAGG - Intergenic
1008936633 6:56999465-56999487 TTGCACAGGCATGAGGAACGTGG - Intronic
1010387099 6:75293338-75293360 TTGCATATGCATGTTGAGATGGG + Intronic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1012777432 6:103515690-103515712 GTGCAAAGGCATGAGAAGCCAGG - Intergenic
1014295203 6:119609221-119609243 TTTCATATGCATGTGAAGACAGG - Intergenic
1017519113 6:155186105-155186127 TTGCATATGAATGAGAGACCTGG - Intronic
1017810895 6:157982374-157982396 TTGCGTATTCATGAGGATCCCGG + Intronic
1021222849 7:17993134-17993156 TTGCATATACATGATGAGGGAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023199770 7:37683782-37683804 TTGCAAATGCATGCAGAGCATGG + Intronic
1023937251 7:44748814-44748836 ATGCATATGCATGAGCGGCGCGG + Intronic
1027186907 7:75977854-75977876 TCACATGTGCATGAGGGGCCAGG + Intronic
1028098489 7:86791614-86791636 TTGCATGTGCACGAGGACTCTGG + Intronic
1034934027 7:155187068-155187090 TTGCACATGCATCAGGAGAGTGG - Intergenic
1036035899 8:5018572-5018594 ATGCATCTGTATGAGGAGCATGG - Intergenic
1036205789 8:6805037-6805059 TTTCATATGCATGAAGAGAGAGG + Intergenic
1036532168 8:9601947-9601969 TTGCATGTGTATGAGGAGGTGGG + Intronic
1041452008 8:58015548-58015570 TTGAAAAGGCATGAGGGGCCGGG + Intronic
1042448169 8:68913650-68913672 TTGCCTATGCATTAGGTTCCAGG - Intergenic
1042487238 8:69360081-69360103 TTGGAGATTCATGATGAGCCTGG - Intergenic
1049365844 8:142236475-142236497 TTTCTCATGCCTGAGGAGCCCGG - Intronic
1050748507 9:8906951-8906973 GTGCATATGCAAGGGGAACCTGG + Intronic
1051093489 9:13437688-13437710 TTGCATAAGGAAGAGGAGTCAGG - Intergenic
1054549918 9:66390503-66390525 TTGCCTAATCATGAGGAGGCGGG - Intergenic
1054980782 9:71203323-71203345 TTGAATATGCATTGTGAGCCAGG - Intronic
1055699963 9:78933281-78933303 TTGCATATGGATGGGAAGCAAGG + Intergenic
1057176598 9:93004753-93004775 TTCCCTCTGCATCAGGAGCCTGG + Intronic
1057809471 9:98246737-98246759 TTGAATCTGCAGGAGGAACCAGG + Intronic
1058426937 9:104883408-104883430 GTGCACATGCATGATGAGCCGGG - Intronic
1191786830 X:64925202-64925224 GTGCACATGCATGAGTGGCCAGG + Intronic
1196172326 X:112603424-112603446 TTGCAGATGGCTCAGGAGCCAGG - Intergenic
1196275790 X:113763919-113763941 TTCCATGAGCATGAGCAGCCTGG - Intergenic
1198681606 X:139188878-139188900 TTGCATTTGCCTTATGAGCCAGG + Intronic
1199778304 X:151034886-151034908 ATGCAAATGGATGAGAAGCCAGG - Intergenic
1202070413 Y:20986091-20986113 TGGCATAAGCATGAAGAACCAGG + Intergenic