ID: 972817900

View in Genome Browser
Species Human (GRCh38)
Location 4:42665017-42665039
Sequence GTGGAGGCCCAGAAATATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972817900_972817905 12 Left 972817900 4:42665017-42665039 CCCAAATATTTCTGGGCCTCCAC No data
Right 972817905 4:42665052-42665074 AACCCTTTAATGTTGCTTATAGG No data
972817900_972817906 13 Left 972817900 4:42665017-42665039 CCCAAATATTTCTGGGCCTCCAC No data
Right 972817906 4:42665053-42665075 ACCCTTTAATGTTGCTTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972817900 Original CRISPR GTGGAGGCCCAGAAATATTT GGG (reversed) Intergenic
No off target data available for this crispr