ID: 972818627

View in Genome Browser
Species Human (GRCh38)
Location 4:42673493-42673515
Sequence TCCAACTGATTCCAAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972818627_972818629 11 Left 972818627 4:42673493-42673515 CCTTTTCTTTGGAATCAGTTGGA No data
Right 972818629 4:42673527-42673549 CATATGGAAGAGATGCTGAGAGG No data
972818627_972818628 -5 Left 972818627 4:42673493-42673515 CCTTTTCTTTGGAATCAGTTGGA No data
Right 972818628 4:42673511-42673533 TTGGATGCATTTAATGCATATGG No data
972818627_972818630 12 Left 972818627 4:42673493-42673515 CCTTTTCTTTGGAATCAGTTGGA No data
Right 972818630 4:42673528-42673550 ATATGGAAGAGATGCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972818627 Original CRISPR TCCAACTGATTCCAAAGAAA AGG (reversed) Intergenic
No off target data available for this crispr