ID: 972819190

View in Genome Browser
Species Human (GRCh38)
Location 4:42680004-42680026
Sequence ATGTCCTGCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972819190_972819193 2 Left 972819190 4:42680004-42680026 CCTTCACTCTTCTAGCAGGACAT No data
Right 972819193 4:42680029-42680051 TTTTTTGGGTCCTTTTTCCATGG No data
972819190_972819195 16 Left 972819190 4:42680004-42680026 CCTTCACTCTTCTAGCAGGACAT No data
Right 972819195 4:42680043-42680065 TTTCCATGGTTTAGAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972819190 Original CRISPR ATGTCCTGCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr