ID: 972819193

View in Genome Browser
Species Human (GRCh38)
Location 4:42680029-42680051
Sequence TTTTTTGGGTCCTTTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972819188_972819193 10 Left 972819188 4:42679996-42680018 CCAGGAGGCCTTCACTCTTCTAG 0: 27
1: 53
2: 45
3: 55
4: 162
Right 972819193 4:42680029-42680051 TTTTTTGGGTCCTTTTTCCATGG No data
972819187_972819193 16 Left 972819187 4:42679990-42680012 CCATTGCCAGGAGGCCTTCACTC 0: 2
1: 0
2: 3
3: 19
4: 235
Right 972819193 4:42680029-42680051 TTTTTTGGGTCCTTTTTCCATGG No data
972819190_972819193 2 Left 972819190 4:42680004-42680026 CCTTCACTCTTCTAGCAGGACAT No data
Right 972819193 4:42680029-42680051 TTTTTTGGGTCCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972819193 Original CRISPR TTTTTTGGGTCCTTTTTCCA TGG Intergenic
No off target data available for this crispr