ID: 972826193

View in Genome Browser
Species Human (GRCh38)
Location 4:42761898-42761920
Sequence GTTCTCTGCCTGGAATTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972826193_972826196 10 Left 972826193 4:42761898-42761920 CCTCTTAATTCCAGGCAGAGAAC No data
Right 972826196 4:42761931-42761953 CCTCCTTTCTGTAAAAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972826193 Original CRISPR GTTCTCTGCCTGGAATTAAG AGG (reversed) Intergenic
No off target data available for this crispr