ID: 972830503

View in Genome Browser
Species Human (GRCh38)
Location 4:42809441-42809463
Sequence GAATCCTATTTTTGGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972830500_972830503 -7 Left 972830500 4:42809425-42809447 CCATTTATTGAATAGGGAATCCT 0: 299
1: 13692
2: 7858
3: 4697
4: 3857
Right 972830503 4:42809441-42809463 GAATCCTATTTTTGGTTGGTAGG No data
972830494_972830503 30 Left 972830494 4:42809388-42809410 CCAGTTTCAATCTTCTGCATATG 0: 549
1: 2073
2: 4933
3: 5396
4: 16011
Right 972830503 4:42809441-42809463 GAATCCTATTTTTGGTTGGTAGG No data
972830499_972830503 -6 Left 972830499 4:42809424-42809446 CCCATTTATTGAATAGGGAATCC No data
Right 972830503 4:42809441-42809463 GAATCCTATTTTTGGTTGGTAGG No data
972830496_972830503 2 Left 972830496 4:42809416-42809438 CCAGTTATCCCATTTATTGAATA No data
Right 972830503 4:42809441-42809463 GAATCCTATTTTTGGTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972830503 Original CRISPR GAATCCTATTTTTGGTTGGT AGG Intergenic
No off target data available for this crispr