ID: 972831633

View in Genome Browser
Species Human (GRCh38)
Location 4:42820623-42820645
Sequence CGAAATGAATAAGACCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972831633_972831636 18 Left 972831633 4:42820623-42820645 CCTTGGTGGTCTTATTCATTTCG No data
Right 972831636 4:42820664-42820686 ATTGTTATGTGACCAAATCCTGG No data
972831633_972831634 -6 Left 972831633 4:42820623-42820645 CCTTGGTGGTCTTATTCATTTCG No data
Right 972831634 4:42820640-42820662 ATTTCGCCAGTGATTAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972831633 Original CRISPR CGAAATGAATAAGACCACCA AGG (reversed) Intergenic
No off target data available for this crispr