ID: 972831635

View in Genome Browser
Species Human (GRCh38)
Location 4:42820646-42820668
Sequence ACAATGCCTAAACTAATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972831635_972831642 23 Left 972831635 4:42820646-42820668 CCAGTGATTAGTTTAGGCATTGT No data
Right 972831642 4:42820692-42820714 ATTACTCAGGGTTCTCTTAGAGG No data
972831635_972831636 -5 Left 972831635 4:42820646-42820668 CCAGTGATTAGTTTAGGCATTGT No data
Right 972831636 4:42820664-42820686 ATTGTTATGTGACCAAATCCTGG No data
972831635_972831638 10 Left 972831635 4:42820646-42820668 CCAGTGATTAGTTTAGGCATTGT No data
Right 972831638 4:42820679-42820701 AATCCTGGCCTGTATTACTCAGG No data
972831635_972831639 11 Left 972831635 4:42820646-42820668 CCAGTGATTAGTTTAGGCATTGT No data
Right 972831639 4:42820680-42820702 ATCCTGGCCTGTATTACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972831635 Original CRISPR ACAATGCCTAAACTAATCAC TGG (reversed) Intergenic
No off target data available for this crispr