ID: 972831636

View in Genome Browser
Species Human (GRCh38)
Location 4:42820664-42820686
Sequence ATTGTTATGTGACCAAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972831633_972831636 18 Left 972831633 4:42820623-42820645 CCTTGGTGGTCTTATTCATTTCG No data
Right 972831636 4:42820664-42820686 ATTGTTATGTGACCAAATCCTGG No data
972831635_972831636 -5 Left 972831635 4:42820646-42820668 CCAGTGATTAGTTTAGGCATTGT No data
Right 972831636 4:42820664-42820686 ATTGTTATGTGACCAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972831636 Original CRISPR ATTGTTATGTGACCAAATCC TGG Intergenic
No off target data available for this crispr