ID: 972832467

View in Genome Browser
Species Human (GRCh38)
Location 4:42830819-42830841
Sequence ACATGTTGACTACTCGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972832462_972832467 14 Left 972832462 4:42830782-42830804 CCATTATAGAGAACGAAAAATAA No data
Right 972832467 4:42830819-42830841 ACATGTTGACTACTCGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972832467 Original CRISPR ACATGTTGACTACTCGGGGG AGG Intergenic
No off target data available for this crispr