ID: 972840152

View in Genome Browser
Species Human (GRCh38)
Location 4:42921259-42921281
Sequence ATCTGCTGGTACCTTGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4825
Summary {0: 3, 1: 62, 2: 537, 3: 1518, 4: 2705}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972840148_972840152 -6 Left 972840148 4:42921242-42921264 CCCTCACCACACATGGAATCTGC 0: 1
1: 18
2: 119
3: 656
4: 1737
Right 972840152 4:42921259-42921281 ATCTGCTGGTACCTTGATCCTGG 0: 3
1: 62
2: 537
3: 1518
4: 2705
972840149_972840152 -7 Left 972840149 4:42921243-42921265 CCTCACCACACATGGAATCTGCT 0: 1
1: 15
2: 66
3: 502
4: 1421
Right 972840152 4:42921259-42921281 ATCTGCTGGTACCTTGATCCTGG 0: 3
1: 62
2: 537
3: 1518
4: 2705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972840152 Original CRISPR ATCTGCTGGTACCTTGATCC TGG Intronic
Too many off-targets to display for this crispr