ID: 972840368

View in Genome Browser
Species Human (GRCh38)
Location 4:42923148-42923170
Sequence CACTCCTCCCTCCCTTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972840368_972840371 4 Left 972840368 4:42923148-42923170 CCTCCATAAGGGAGGGAGGAGTG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 972840371 4:42923175-42923197 AGAGATAGCCCTGCCTTCCCAGG 0: 1
1: 1
2: 1
3: 29
4: 222
972840368_972840377 26 Left 972840368 4:42923148-42923170 CCTCCATAAGGGAGGGAGGAGTG 0: 1
1: 0
2: 1
3: 15
4: 179
Right 972840377 4:42923197-42923219 GCTAACAACTGCCTACTCAATGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972840368 Original CRISPR CACTCCTCCCTCCCTTATGG AGG (reversed) Intronic
900121957 1:1052055-1052077 CACTCCTCCATCCTTCCTGGTGG + Intronic
906033610 1:42738057-42738079 CAGGCCTCCCGCCCCTATGGAGG + Intronic
908252078 1:62273491-62273513 GTCTCCTCCCTCCCTGCTGGGGG + Exonic
911325837 1:96469779-96469801 CCCACCTCCCTCCCGGATGGGGG + Intergenic
912563814 1:110570528-110570550 CCCTCCTCCCTCCCTGCGGGTGG + Intergenic
917516623 1:175713974-175713996 CTCTCCTCTCTCCCTCATGCTGG + Intronic
920079574 1:203362473-203362495 CACTCCTGCCTCTCTTCAGGAGG - Intergenic
920234192 1:204492113-204492135 CAGATCTCCCTCCCTTATGTGGG + Intronic
921182690 1:212644230-212644252 CACTGCTCCCTCCCTGATCATGG + Intergenic
922102536 1:222487970-222487992 CCCACCTCCCTCCCGGATGGGGG - Intergenic
922988611 1:229886210-229886232 CCCTCCTCCTGCCCTTTTGGTGG + Intergenic
923527149 1:234781299-234781321 CTCTCCTCCTTCCCTCAAGGTGG - Intergenic
1063958282 10:11284953-11284975 CACTCATCCATCCCTCATTGTGG - Intronic
1064348450 10:14554485-14554507 CTCTCCTGCCTCCCTTCTGTTGG - Intronic
1065627454 10:27646516-27646538 GAGTCCTCCATCCCATATGGGGG + Intergenic
1066044303 10:31582705-31582727 CGCAGCTCCCTCCCTTTTGGGGG - Intergenic
1066555875 10:36612486-36612508 CTCTCCTCCCACCCTTCTGTGGG + Intergenic
1068590802 10:58851044-58851066 CATTCCTCCCTCCCAGAGGGAGG + Intergenic
1069809530 10:71148138-71148160 CACTCTCCCCTCCCTGAAGGAGG - Intergenic
1070026691 10:72638607-72638629 CACCACTCCCTGCCTTATCGAGG + Intergenic
1073317483 10:102593169-102593191 AACTCCTCCCTTCCTTATTAGGG - Intronic
1075397969 10:122141443-122141465 CCCTCCTCCCTTCCTTCTGTTGG - Intronic
1077885542 11:6384883-6384905 CACTCTGTCCTTCCTTATGGAGG - Intergenic
1083471187 11:62885155-62885177 AACTCCTCCCTCCCCTCTGCAGG + Exonic
1084394748 11:68901868-68901890 CACTCCTCCCTCTCACATGAGGG + Intronic
1084725209 11:70937365-70937387 CACTGCTGCCTGCCTGATGGAGG + Intronic
1090095805 11:123741180-123741202 CACTCCTCCCTCGGTTCCGGGGG + Intronic
1090346979 11:126079469-126079491 CACTACTGCCTGCCTCATGGTGG + Intergenic
1091468353 12:705115-705137 CCCTCCTTCCTTCCTTATTGTGG + Intergenic
1091604426 12:1937888-1937910 CACTTCTCCCTTCCTTATGAAGG - Intergenic
1092047925 12:5445758-5445780 CTCTCCTCCCTGCCTTTTGGCGG + Intronic
1093637590 12:21489865-21489887 CCCTCCTCTCTCCCTAAAGGAGG - Intronic
1096231172 12:49897681-49897703 CACTCCACCCTCCTTTTTGGGGG + Intronic
1096700380 12:53379480-53379502 CCCTCTTCCCTCCCTCATGATGG + Intergenic
1097726595 12:63081955-63081977 CACTCCACCCTCACTTATTGAGG - Intergenic
1105514481 13:21077389-21077411 CACTCCTCTCACACTCATGGAGG + Intergenic
1106885799 13:34182927-34182949 CGCTCCTCCCTCCTCTCTGGGGG + Intergenic
1110690675 13:78427454-78427476 CCCTTCTCCCTTCCTTCTGGGGG + Intergenic
1111052347 13:82901342-82901364 CAAACCTCCCTCCATGATGGGGG + Intergenic
1112504486 13:99968151-99968173 CACGCCGCTCTCCCTTTTGGGGG - Intronic
1112535347 13:100248343-100248365 CATTCCTCCCTCCACTATGTTGG + Intronic
1113381463 13:109809813-109809835 CACTCCTCCCTCCTCCAGGGCGG - Intergenic
1114271307 14:21101983-21102005 CCTTCCACCCTCCCTTGTGGTGG - Intronic
1121634313 14:95443326-95443348 CACCTCTCCCTCCCTTGGGGTGG + Intronic
1122348777 14:101076137-101076159 CACTCCTTCCTCCCTCATTAGGG - Intergenic
1122598035 14:102907155-102907177 CACACCTGCCTCCCTCAGGGTGG - Exonic
1126453246 15:48833507-48833529 CTCCCCTCCCTCCCTTCTGAAGG + Intronic
1127383139 15:58446683-58446705 CACACCTCTCTCCCTGCTGGAGG + Intronic
1127765258 15:62179618-62179640 CATTCCTCCCTCTGTTAGGGTGG - Intergenic
1129206083 15:74037729-74037751 CACTCCTCCCTCTCCTCTGCAGG + Intronic
1129656512 15:77528464-77528486 CCCTCCTCCCCACCTTCTGGGGG - Intergenic
1129826831 15:78640169-78640191 ACCTCCTGCCTCCCCTATGGTGG + Intronic
1130650523 15:85759837-85759859 CACCCCTCCCTCTCAAATGGTGG + Exonic
1132701406 16:1223673-1223695 CACACCTCCCTGCCTTCTTGGGG + Intronic
1132706235 16:1244617-1244639 CAGACCTCGCTCCCTTATGTGGG + Intergenic
1133723625 16:8517622-8517644 CACTCCTCCCTCCATGAGTGTGG + Intergenic
1134768144 16:16780565-16780587 CACACCTCCCTCCCAAATGTGGG - Intergenic
1136634027 16:31508014-31508036 CACTCCTCCCTCCCCAATAATGG - Intronic
1138264534 16:55651066-55651088 CACACCTCCCCACCTCATGGTGG - Intergenic
1140033124 16:71354250-71354272 CAAGCCTCCCTCCCTTCTTGAGG + Intergenic
1143691699 17:8572707-8572729 CACTCCTCCGTCCCTGTTGCTGG + Intronic
1144967171 17:19084641-19084663 CATTACTCCATCCCATATGGAGG + Intergenic
1144980749 17:19167426-19167448 CATTACTCCATCCCATATGGAGG - Intergenic
1144987473 17:19210807-19210829 CATTACTCCATCCCATATGGAGG + Intergenic
1146057014 17:29586541-29586563 CTCCTCTTCCTCCCTTATGGAGG - Intronic
1147610794 17:41800930-41800952 CACTCCTTCCTCCCATAGGTGGG - Intergenic
1147695651 17:42350623-42350645 CACTTCTCCCTCCCTCTTTGGGG + Intronic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1147836844 17:43338925-43338947 TACTCCACCATCTCTTATGGAGG - Intergenic
1148000610 17:44385126-44385148 TACACCTCCCTCCCTTCTCGCGG - Intronic
1150984947 17:70185408-70185430 CACTCCTCCCTGCCTTTTCCAGG + Intergenic
1151344831 17:73495129-73495151 CACCCCTCGCTCCCTCTTGGGGG - Intronic
1151853867 17:76708379-76708401 CCCTCCTCCCTCGCTGTTGGTGG + Intronic
1162728312 19:12702773-12702795 CACCCCTGCCTGCCTTCTGGAGG - Intronic
1162789397 19:13055232-13055254 CACTCCTCCCTCCCACTTAGAGG + Intronic
1165105897 19:33469566-33469588 CTCTCCTCCCTCCCTTTTAAGGG + Intronic
1165893570 19:39128720-39128742 CCCTCCTCCCTCCCTTCCAGGGG + Intronic
1166319372 19:42006807-42006829 CACCCCTCCCACCCTTCAGGTGG - Exonic
1166472164 19:43087760-43087782 CACTCCTCCACCTCTTGTGGAGG - Intronic
925322973 2:2991107-2991129 CACTCCTCCCACCCTCAGTGAGG + Intergenic
926304104 2:11625456-11625478 CATTCCTCCCTTCCTTATACAGG - Intronic
927146586 2:20170129-20170151 CACGCCTCCCTCCAGCATGGCGG + Intergenic
927640268 2:24841419-24841441 CACTCCTCCCTCACTGAGGAGGG - Intronic
929351325 2:40959320-40959342 CACTTGTCCCTTCCTTATGGAGG - Intergenic
929614752 2:43297930-43297952 CCCACCTCCCTCCCGGATGGCGG - Intronic
931750327 2:65324567-65324589 TACTCTTCCCTCTCTTATGGAGG + Intronic
931766769 2:65463772-65463794 CACTCCTTCCTTTCTTCTGGTGG + Intergenic
932382576 2:71298847-71298869 CCCTCCTCCCTCCCTAAGGAGGG + Intronic
932672975 2:73754220-73754242 TACTCCTCCACCTCTTATGGAGG + Intergenic
936857789 2:116980806-116980828 CTCTCCTCCCTCCCTAAGGATGG - Intergenic
939781128 2:146449603-146449625 CACTCATGCCTCCCTTCTGTGGG + Intergenic
941566788 2:167118597-167118619 CATTCCTCCCTTCCCTCTGGAGG + Intronic
946063045 2:216961196-216961218 CTCTCCTCCCTCCCTTCTCATGG + Intergenic
946677770 2:222180701-222180723 CACTCCTCCCACCCTTTTTGAGG + Intergenic
948383822 2:237569108-237569130 AAATCCTCCCCCCATTATGGTGG - Intergenic
1168820332 20:768718-768740 CTCTGCCCCCTCCCTTCTGGGGG + Intergenic
1169388305 20:5169328-5169350 CACTCCTGCCTCACTCCTGGTGG - Intronic
1169965759 20:11215446-11215468 CACCCCTCCCTCCCTTATAAAGG - Intergenic
1170775429 20:19371193-19371215 CCCTGCTCCCTCCCCTATTGGGG - Intronic
1171145092 20:22774594-22774616 CACTCCTCCCTCTCTTCTTATGG - Intergenic
1172728942 20:37069777-37069799 CCCACCTCCCTCCCGGATGGGGG - Intronic
1174286084 20:49474526-49474548 TAGTTATCCCTCCCTTATGGGGG + Intronic
1174401924 20:50280551-50280573 CATGCCTCCCTCCCTCCTGGGGG - Intergenic
1174641531 20:52048719-52048741 CCCTCCTCCCTCCTTTTTGGGGG + Intergenic
1174838202 20:53877557-53877579 CAGTGCTCCCTTCCTTGTGGAGG + Intergenic
1176420330 21:6508889-6508911 TACTCCTCCATCTCTTGTGGAGG - Intergenic
1177958956 21:27637648-27637670 CACCCCTGCCTCCCTTTTGTAGG - Intergenic
1179695822 21:43117209-43117231 TACTCCTCCATCTCTTGTGGAGG - Intergenic
1179882515 21:44299568-44299590 CCCTCCTCCCTCACTTTTGCTGG - Intergenic
1180060982 21:45384984-45385006 CACTTTCCCCTCCTTTATGGAGG - Intergenic
1180155327 21:45974677-45974699 CTCCCCTCCCTCCTTTGTGGGGG - Intergenic
1182035611 22:27195921-27195943 CCCTCTTCCCTCCCTTCTGTGGG + Intergenic
1183308369 22:37096086-37096108 CACTTCTGCCTGCCTTAGGGAGG - Exonic
1184767217 22:46577963-46577985 CTCTCCTCCCTCCCTTGTCCAGG - Intronic
1185289786 22:50017525-50017547 CCCTCCTCCTTCACTTAGGGTGG - Intronic
950132750 3:10558508-10558530 CAGTCCTGACTCCCTTATGCTGG - Intronic
950171845 3:10844192-10844214 CTCTCCACCCTCCCTTCTGCAGG + Exonic
950491106 3:13305604-13305626 CACTTCTCCCTGCCTGATTGGGG - Intergenic
950891061 3:16404819-16404841 CACTCGTGCCTCTCCTATGGAGG + Intronic
951352833 3:21627558-21627580 TACTCCTCCTTCCTTTATTGGGG + Intronic
952618173 3:35300932-35300954 CACCTCTCCTTCCCTTATTGAGG + Intergenic
954453508 3:50584505-50584527 CACTCCTGCCTCCTTTACAGAGG - Exonic
955474280 3:59319915-59319937 CAGTTTTCCCTTCCTTATGGAGG + Intergenic
955773140 3:62406098-62406120 CACTGCTCCATCCCTTAGGGAGG - Intronic
956620254 3:71214734-71214756 CGCTCCTCTCTCTCTTTTGGGGG - Intronic
960638990 3:119809623-119809645 CTCAGCTCCCTCCCTTAAGGAGG + Intronic
960896196 3:122508365-122508387 AACTCCTCACTACCTTAAGGAGG - Intronic
961429107 3:126867797-126867819 CTGTCCTCCCTCCATGATGGTGG + Intronic
963015763 3:140822379-140822401 GACTCCTACCTCCCTTAATGAGG + Intergenic
963868227 3:150385690-150385712 CACTCCTGCCTCCATTCTGGGGG - Intergenic
968472431 4:788233-788255 CCCTCCTTCCTCCCAAATGGAGG + Intronic
969160138 4:5249905-5249927 CTCTCCTCCCACCCTCAAGGAGG + Intronic
970032977 4:11698629-11698651 GACTCTTCCCTACCTTAGGGTGG - Intergenic
970942889 4:21656150-21656172 CCCTCCTCCCTAGCTTCTGGTGG + Intronic
971796023 4:31229518-31229540 CACTTCTCCCTCACTGATAGAGG + Intergenic
972840368 4:42923148-42923170 CACTCCTCCCTCCCTTATGGAGG - Intronic
976080095 4:81345972-81345994 TACTCCCCCCTCCCTTAGGGGGG + Intergenic
977416149 4:96734640-96734662 CTCTTTTCCCTCCATTATGGAGG - Intergenic
979698861 4:123644348-123644370 CCCTCCTCCCTCCCATCTAGTGG - Intergenic
981513846 4:145586069-145586091 CACTCCTCCCACCTCTATGGAGG + Intergenic
987276059 5:16363951-16363973 CACTTCTCTCACCCTTATCGGGG - Intergenic
994026629 5:95091615-95091637 GACTCCTCCCTCTCTTCTTGTGG - Intronic
995244373 5:109919871-109919893 CACACCTTCCACCCTTATGTAGG + Intergenic
995538127 5:113157718-113157740 CAGACCTCCCTCCATTAAGGGGG - Intronic
1000633844 5:163621182-163621204 CTCTCCTTCCTCTCTTATAGAGG - Intergenic
1002305377 5:178279815-178279837 CACACCTCCCTTCCTCAAGGCGG + Intronic
1002764579 6:228040-228062 TGCACCTCTCTCCCTTATGGGGG + Intergenic
1003019091 6:2494593-2494615 CACTCTTCCCCACTTTATGGAGG + Intergenic
1003306742 6:4935896-4935918 CTCTGCTCCCTCCCTTCTGGTGG - Intronic
1003905518 6:10695575-10695597 CAGTCCTCCACCCCTTATGTAGG - Intronic
1004582489 6:16967541-16967563 CACTCATCCCTCCCTAATCCTGG + Intergenic
1005119157 6:22371215-22371237 CACGCCCCCCTCCCTTAAAGGGG + Intergenic
1005386507 6:25290498-25290520 CACTCCTCTCTCCAGGATGGTGG + Intronic
1015392324 6:132696721-132696743 CATTTCTCCCTCCCTTTTGAAGG - Intronic
1016019463 6:139220469-139220491 CACTCCTGCCTCCCTTTGGATGG - Intergenic
1016183048 6:141170845-141170867 CACTGCTCCACCCCTTGTGGTGG + Intergenic
1019611669 7:1939922-1939944 CTCTCCTCTCTCCCTGTTGGAGG - Intronic
1022220814 7:28311870-28311892 CACTCCTCCCTCCCCAGTGTCGG + Intronic
1022298964 7:29084473-29084495 CACTTGTCCCTGCCTGATGGTGG + Intronic
1022302692 7:29115909-29115931 CACTCATCCCTCCCTTCCTGAGG + Intronic
1022462396 7:30622746-30622768 CACTTCTCTCTCCTTTTTGGAGG + Intronic
1023074300 7:36467793-36467815 TACTCCTCCATCTCTTGTGGAGG + Intergenic
1023156521 7:37257218-37257240 CATTCCTTCCTCCCTCATGATGG + Intronic
1023609476 7:41958596-41958618 CCCTCCTCCCTTTCTTATGCAGG + Intergenic
1024636640 7:51296150-51296172 CAGTCCTCCCTTCTTTATTGTGG + Intronic
1025616966 7:63128395-63128417 CTCTCCTCCCACCCTCAAGGAGG - Intergenic
1029484274 7:100829594-100829616 CCCTCCTCCCTCCCCGATGCAGG + Intronic
1029596294 7:101539105-101539127 GACTCCTGCCTCCCTCAAGGAGG + Intronic
1031688980 7:124765336-124765358 CACTCCTCACTGCCTTTGGGTGG + Exonic
1034544235 7:151779415-151779437 CTCTCCTCCCACCCCCATGGAGG + Intronic
1037902350 8:22695246-22695268 CCCGGCTCCCTCCCTTAGGGGGG + Intergenic
1041576358 8:59400302-59400324 CATTTCTCCCTCCCTTTTGAAGG - Intergenic
1043544437 8:81299632-81299654 CCCTCTTCCCTCCCTTATTTTGG + Intergenic
1044493322 8:92846782-92846804 CCTTCCTTCCTCCCTTGTGGAGG - Intergenic
1044493400 8:92847348-92847370 CCCTCCTTCCTCCCTTATGGAGG + Intergenic
1047250996 8:123182204-123182226 CACCCCTCCCTGCCCTATGAAGG - Exonic
1048845792 8:138602698-138602720 CAGTCCCCACTCCCTTCTGGAGG + Intronic
1049260521 8:141636538-141636560 CCTTCCTCCCTCCTTTAGGGAGG + Intergenic
1052741920 9:32401712-32401734 CACTCCTCCCACCCTTTTACTGG + Intronic
1054751875 9:68915637-68915659 CACTCCTCCTTCCATTAGGAAGG + Intronic
1059172238 9:112136613-112136635 CGCTCCTCCCTCACCCATGGTGG + Intronic
1060781644 9:126417453-126417475 CTCACCTCTCTCCATTATGGAGG - Intronic
1060894445 9:127208707-127208729 CACTCCTCACTCCTTGAGGGAGG + Intronic
1061037983 9:128124006-128124028 CACACCTCCCTCTCTTGGGGAGG - Intronic
1186210304 X:7243708-7243730 CTCACCTCCCTCCCTTTTCGGGG - Intronic
1186611971 X:11146313-11146335 CACTGTTTCCTCCCTGATGGAGG - Intronic
1186637965 X:11426942-11426964 ACCTTCCCCCTCCCTTATGGTGG - Intronic
1186740064 X:12507838-12507860 GACTCCTCCCTTCCTTTTGGTGG + Intronic
1188028947 X:25242477-25242499 AATTCCTGTCTCCCTTATGGTGG - Intergenic
1188094994 X:26010447-26010469 CAGTTTTCCCTCCCTTTTGGGGG - Intergenic
1190980580 X:55453914-55453936 CAGTGCTCCCTCCCCTATGCTGG - Intergenic
1190988117 X:55519266-55519288 CAGTGCTCCCTCCCCTATGCTGG + Intergenic
1198685026 X:139219815-139219837 TGCTGATCCCTCCCTTATGGTGG + Intronic
1200075239 X:153547421-153547443 ACCTCCTACCTCCCTTAGGGAGG - Intronic
1200322881 X:155208043-155208065 CACTTCTCCCTCACTGATTGAGG - Intronic