ID: 972848470

View in Genome Browser
Species Human (GRCh38)
Location 4:43018893-43018915
Sequence CTCTTCATTTATTGGTAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972848470 Original CRISPR CTCTTCATTTATTGGTAGTT GGG (reversed) Intronic
902077974 1:13802564-13802586 CTCTTCTTTTCTTGGTCCTTGGG + Intronic
902737360 1:18409992-18410014 CTCTCCATTTAAGGGTAATTTGG + Intergenic
903104069 1:21059534-21059556 CTCTTTTTTTCTTGGTGGTTGGG - Intronic
906634868 1:47402637-47402659 CTCTTTACTTATTGATAGGTGGG + Intergenic
907756023 1:57311620-57311642 ATCTTCATTTATTGGGAGCAAGG - Intronic
911341347 1:96642777-96642799 TTTTTCACTTATTGGTAGTCAGG - Intergenic
912053500 1:105564059-105564081 TTCTCAATTTTTTGGTAGTTTGG - Intergenic
912111195 1:106345278-106345300 CTCTTCATTAGTAGGTAATTGGG - Intergenic
912256594 1:108065709-108065731 TTCTTCATTTATTGTCTGTTTGG - Intergenic
913610357 1:120504520-120504542 CTCTTCATGTCCTGGTGGTTTGG - Intergenic
914580833 1:149017719-149017741 CTCTTCATGTCCTGGTGGTTTGG + Intronic
916777044 1:167977689-167977711 CTCTCCATTTTTTTGTAGTCTGG + Intronic
918389917 1:184048512-184048534 CTTTTCATTCATTGGTTGTAAGG - Intergenic
918666496 1:187157377-187157399 CTCTTCATTTACTTTTTGTTTGG + Intergenic
918850633 1:189684111-189684133 CTCCTCTTATATTGGGAGTTTGG - Intergenic
919458061 1:197843468-197843490 CTCTTCATTTATTTGCTTTTAGG - Intergenic
920835646 1:209508480-209508502 CTCTTCCTTTATTGCTAGTCTGG + Intergenic
923394100 1:233543680-233543702 GTCTTCCTTGATTGGGAGTTTGG - Intergenic
1063376376 10:5557032-5557054 CTTTTGATTTATTAATAGTTGGG + Intergenic
1064564737 10:16628184-16628206 CTTTTCATTAATTAGCAGTTTGG + Intronic
1065589287 10:27249708-27249730 CTCTTGATATACTGGAAGTTGGG + Intergenic
1067140360 10:43651035-43651057 AACTTCATTTAGTGGTACTTTGG - Intergenic
1068692308 10:59929548-59929570 ATCTTCATACATTGATAGTTGGG + Intergenic
1068852907 10:61764705-61764727 CTTTTCCTTTCTTGGTGGTTGGG - Intronic
1068876236 10:61999696-61999718 CTTTACATTTATTTCTAGTTTGG - Intronic
1070169890 10:73925035-73925057 CTCTTCTTTTAGTGGTCCTTTGG - Intergenic
1071136921 10:82464429-82464451 TTCTTCTTTAATTGGTAGTTTGG - Intronic
1072130625 10:92490739-92490761 CTATTCATGTATTGCTTGTTTGG - Intronic
1072159780 10:92755232-92755254 TCCTTCATTCATTGGTCGTTTGG + Intergenic
1073010553 10:100356019-100356041 CTGTTCATTAGTTTGTAGTTTGG + Intronic
1073777590 10:106803201-106803223 ATTTTCATTTATTGGTACATTGG - Intronic
1076576249 10:131471395-131471417 CACTTCATGGATAGGTAGTTTGG + Intergenic
1077732134 11:4742744-4742766 CTCTTTATTCATTGGTAAATTGG + Intronic
1078498947 11:11849865-11849887 CTCTTGTTTTATGGATAGTTTGG + Intronic
1080408877 11:32004674-32004696 CACTTCATTTATTAGTCTTTTGG - Intronic
1081393272 11:42555244-42555266 CTCTTTATTTAAGGGTACTTTGG + Intergenic
1085675629 11:78514850-78514872 CTTTTCTTTAATTGCTAGTTAGG - Intronic
1086755988 11:90562642-90562664 CTCTACATTGCTTGGAAGTTTGG - Intergenic
1087711329 11:101556255-101556277 CTCTTCATTTGTTGATCTTTTGG - Intronic
1088838694 11:113603719-113603741 CTCTTCTTTTCTTGGTAGCAGGG + Intergenic
1089237185 11:117039837-117039859 TTCTTCATTTATTAGCAGTTTGG - Intronic
1090791850 11:130096840-130096862 TTATGCATTTATTAGTAGTTAGG + Intronic
1090930112 11:131290064-131290086 CTTTCCATTTCTTGGTGGTTGGG + Intergenic
1095496573 12:42790681-42790703 AGCTACATTTATTGGTATTTTGG - Intergenic
1095925551 12:47575677-47575699 AGCTTCATTTATGGCTAGTTGGG - Intergenic
1097202272 12:57289349-57289371 CTCTGAATTTATTGGTAACTTGG + Intronic
1098164696 12:67682341-67682363 CTCTTGATCGATTGATAGTTTGG - Intergenic
1099198846 12:79651864-79651886 CACTTCATTCATTGGTAGCTTGG - Intronic
1099829156 12:87817651-87817673 CTCTTCACCTTTTTGTAGTTAGG - Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1106758848 13:32848401-32848423 TTCTTTACTTACTGGTAGTTAGG - Intergenic
1107399826 13:40058613-40058635 CTCATCATTAATGGGTAGTTTGG - Intergenic
1109185202 13:59259887-59259909 CTCTTCCTTTCTTTGTAATTTGG - Intergenic
1109928344 13:69178384-69178406 ATTTTCAATTATTTGTAGTTTGG - Intergenic
1111405858 13:87804571-87804593 CTGTTCATTGCTTGCTAGTTTGG - Intergenic
1113349161 13:109511584-109511606 ATTCTCATTTATTGGTTGTTTGG - Intergenic
1115927352 14:38450037-38450059 CTATTCAGTTATTGGTACTGTGG - Intergenic
1115983463 14:39079177-39079199 CTCTCATTTCATTGGTAGTTTGG - Intronic
1116024957 14:39503980-39504002 TTCTGCATCTATTGGGAGTTAGG + Intergenic
1117132546 14:52700316-52700338 ATCTTCATTTATTAGTACTGTGG - Intergenic
1117135261 14:52729729-52729751 CTCTTCATTTATTAGTCATTTGG + Intergenic
1117469982 14:56033959-56033981 TTCTTCTTTTATTGGCATTTGGG - Intergenic
1117793805 14:59370176-59370198 TGCTTTATTTATTTGTAGTTGGG + Exonic
1118717666 14:68571763-68571785 TTGTTCAGTTATTGGTTGTTTGG + Intronic
1118805738 14:69235236-69235258 CTTTTTATTTATTGACAGTTGGG + Intronic
1120872557 14:89351063-89351085 TTCTCATTTTATTGGTAGTTTGG - Intronic
1121621289 14:95350557-95350579 CTCTTCAGTTATTGCCATTTTGG + Intergenic
1122739522 14:103863721-103863743 CTTTTCATTTTTTCGTATTTTGG + Intergenic
1122995922 14:105264136-105264158 TTCTTCATTTCTTCATAGTTAGG - Intronic
1124442478 15:29697154-29697176 CTCTTCATTTCTTGTCAGTGGGG - Intergenic
1124470187 15:29977263-29977285 TTCTTCACTCATTGGTAGTAAGG - Intergenic
1128903786 15:71449813-71449835 CTTTTCATTTTCTAGTAGTTGGG - Intronic
1129203709 15:74022642-74022664 CTCATGTGTTATTGGTAGTTTGG + Intronic
1129316344 15:74747487-74747509 CTCTCGATTTATTGATAGATAGG + Intergenic
1136138172 16:28270747-28270769 CTCTCACTTTATTAGTAGTTTGG - Intergenic
1140326680 16:74011051-74011073 GTCTTTATTTCTTTGTAGTTTGG - Intergenic
1140601881 16:76486141-76486163 ATCTCCATTGAATGGTAGTTTGG - Intronic
1145948137 17:28793582-28793604 CTCTTCTTTCATTGTTAGTGAGG + Intronic
1145956468 17:28858255-28858277 CCTTTCATTCCTTGGTAGTTTGG + Intronic
1149976619 17:61272103-61272125 CTCTTCAATTAATGGTAGCCAGG - Intronic
1150784235 17:68150103-68150125 CTCTTGATATACTGGAAGTTGGG + Intergenic
1150865333 17:68843044-68843066 CTCTTCATTTATTGACACTCTGG + Intergenic
1151206229 17:72509645-72509667 CTACTCATTTATTGGTGGTAAGG - Intergenic
1153327680 18:3837922-3837944 CTCTTGATTTTATGATAGTTTGG + Intronic
1156113173 18:33752941-33752963 GTCTGCTTTTATCGGTAGTTTGG + Intergenic
1157996424 18:52562527-52562549 CTCTTCATTTCTTGGAAACTTGG - Intronic
1158299788 18:56038384-56038406 CTCTTCATTTATCAATAATTGGG - Intergenic
1162426278 19:10598283-10598305 CCCTTCAAGTATTGGGAGTTAGG + Intergenic
1165670203 19:37671891-37671913 CTTGTTTTTTATTGGTAGTTTGG - Intronic
1166149589 19:40862696-40862718 CTCTTGTTTTGTTGGTTGTTTGG - Intronic
926637915 2:15203802-15203824 TTATTCACTTATTAGTAGTTAGG - Intronic
927838825 2:26423630-26423652 CTAGTCATTTATTGGTAACTTGG + Intronic
930383148 2:50657487-50657509 ATCTTCATTTTTTGTTTGTTTGG + Intronic
930858222 2:56041886-56041908 CTCTACATTTGTTCGAAGTTAGG - Intergenic
931430736 2:62206934-62206956 GTCTCAATTTCTTGGTAGTTAGG - Intronic
931483934 2:62671366-62671388 TTCATCCTTTATTGGTAGTAAGG - Intergenic
931604517 2:64039542-64039564 CTCATACTTTATTGGTGGTTTGG - Intergenic
932108481 2:68971315-68971337 CTCTCCATTTTCTGATAGTTAGG - Intergenic
932639731 2:73432111-73432133 TTCTTCATTTCTTCGTAGGTGGG + Intronic
933078245 2:77955762-77955784 CTTTTCTTTTATTGTTAGTGTGG - Intergenic
933296338 2:80495471-80495493 CTTTTCTTTTTTTGGTGGTTGGG - Intronic
933337225 2:80974142-80974164 GATTTCATTTAGTGGTAGTTTGG - Intergenic
933380924 2:81544203-81544225 CTCTTCATTATTTGTTAATTTGG + Intergenic
937827681 2:126385402-126385424 CATTTGATTTTTTGGTAGTTTGG + Intergenic
938409289 2:131050784-131050806 CTCTTCATTTGCTGGTAGCTGGG - Exonic
938637629 2:133246795-133246817 CTCCTCATTTAATGTTATTTGGG - Intronic
939727309 2:145738245-145738267 CTATAGATTTATTGGTAGTCTGG - Intergenic
939938409 2:148320302-148320324 CTTTTGTTTTATTGGGAGTTTGG + Intronic
940455109 2:153887427-153887449 CTATTTATTTATTGGCACTTGGG - Intronic
1168871518 20:1132718-1132740 CTCTCCATTTATTAATATTTAGG + Intronic
1168983902 20:2031145-2031167 CTTTTCTTTTATTGCTAGTGAGG + Intergenic
1170094113 20:12626781-12626803 CTCCTGACTTATTGGTTGTTTGG + Intergenic
1170520280 20:17178134-17178156 CTCTCCATTGATGGGTATTTGGG + Intergenic
1174671335 20:52310622-52310644 TTGTCCATTTATTGGCAGTTGGG - Intergenic
1174844513 20:53930120-53930142 CTCTTGAAATATTGGAAGTTGGG - Intergenic
1178062480 21:28867251-28867273 CTATTCATTTATTCATACTTTGG - Intergenic
1179171902 21:38979672-38979694 CTCTGCACTTGTTGGTAGCTGGG - Intergenic
1179356366 21:40664326-40664348 CTCTTCATTTATTGTTATCAAGG + Intronic
1181143255 22:20823362-20823384 TTCTTCATTTATTTGTAGGTTGG - Intronic
1181373167 22:22433966-22433988 CTGTTGATTTATGGGCAGTTGGG + Intergenic
1183124940 22:35768048-35768070 CTCCTCATTTATTGGTTGTTTGG - Intronic
1183866565 22:40708917-40708939 ATATTTATTTATTTGTAGTTTGG + Intergenic
1184621838 22:45685457-45685479 CTGTACATTTTTTGTTAGTTTGG + Intronic
949446864 3:4144271-4144293 TTCTTCTTATAGTGGTAGTTTGG + Intronic
951455873 3:22891501-22891523 CTTATGATTTATTGGTTGTTGGG - Intergenic
955741963 3:62100669-62100691 CTCTTAATTTTTTAGTTGTTTGG + Intronic
955980217 3:64517673-64517695 CTCTTCATATATTGGTATTTTGG + Intronic
956683066 3:71799478-71799500 TTCCTCATTTATTGGAAGTAGGG + Intergenic
958511304 3:95052705-95052727 CTCTCCATTTATATGTATTTAGG - Intergenic
958511424 3:95054429-95054451 ATCTTCATATATTGCTAGTGGGG + Intergenic
959982565 3:112532446-112532468 GTCTTCACTTATTGTTACTTAGG + Intergenic
959983309 3:112543552-112543574 TTCTTCAATTACTGGTAATTTGG - Intronic
965660854 3:171040403-171040425 CTCTTGCTTTATTGCTAATTTGG + Intergenic
966030954 3:175347579-175347601 GTCATCATTTATTGTTATTTTGG - Intronic
966093206 3:176165457-176165479 CTCCTCATTCATTGGTTGATGGG - Intergenic
966573108 3:181469104-181469126 CTCTTCATTTATTGGACTTTAGG - Intergenic
967366349 3:188690708-188690730 TTCTTCTTTTAGGGGTAGTTTGG + Intronic
968013632 3:195305420-195305442 CTCATATTTGATTGGTAGTTTGG - Intronic
971505254 4:27359320-27359342 CTTTGCATTTATTGGGGGTTGGG + Intergenic
972274469 4:37544130-37544152 CTCTCACTTAATTGGTAGTTTGG + Intronic
972848470 4:43018893-43018915 CTCTTCATTTATTGGTAGTTGGG - Intronic
973160526 4:47010429-47010451 CTAGTCAGTTAATGGTAGTTAGG + Intronic
973561215 4:52138093-52138115 CTTTATCTTTATTGGTAGTTGGG + Intergenic
977079800 4:92510723-92510745 TTTATCATTTATTTGTAGTTTGG - Intronic
977380223 4:96263656-96263678 CTCTTTGTTTGTTTGTAGTTAGG - Intergenic
977478555 4:97543510-97543532 TTCTTCATTTATTAATATTTAGG - Intronic
978366351 4:107987108-107987130 GTCTTCATTTATTTTTAGGTTGG - Intergenic
978758957 4:112334482-112334504 AGCTTCATTTATTGGCAGTATGG - Intronic
979467177 4:121054150-121054172 CTCTTCATTTTTTGCTCTTTTGG - Intronic
980402659 4:132312822-132312844 CTCTTGATTTATTAGTTATTTGG + Intergenic
980846295 4:138329433-138329455 CTCATCATTTATTGGCATCTAGG + Intergenic
981928191 4:150162396-150162418 CTCTTCAAGTATTGGGATTTAGG + Intronic
983248547 4:165317908-165317930 CTGTCCATTTATCGGTTGTTGGG - Exonic
984321747 4:178206445-178206467 TTATCCACTTATTGGTAGTTTGG - Intergenic
986581343 5:9269538-9269560 CTCACCATTTTTTGGTAATTAGG - Intronic
988685186 5:33518913-33518935 CTCTTCTTTTTTTGGGAGGTGGG - Intergenic
989463926 5:41732219-41732241 CTCTTCATTAATATGTATTTAGG - Intronic
990524506 5:56611439-56611461 CTTTTCATTTTTTGGTAATATGG - Intergenic
990836982 5:60032921-60032943 CTCTTTATTTCTTTGAAGTTAGG + Intronic
991106755 5:62852119-62852141 CTGTTCATTTCCTGGTATTTTGG + Intergenic
993070754 5:83160611-83160633 CTCTTAATTTATTCTTACTTCGG + Intronic
994505139 5:100633431-100633453 CTCTTCATTAATATGCAGTTTGG - Intergenic
996472940 5:123880878-123880900 TTCTTCATTTAGTGGTATTTGGG + Intergenic
997298086 5:132782095-132782117 CTCTACACTTTTTGGTAGTCTGG + Intronic
999596147 5:153206867-153206889 CTTTTTCTTTTTTGGTAGTTAGG + Intergenic
1001772236 5:174305224-174305246 CTGTTCATTCATTGGTGGTGTGG + Intergenic
1003260464 6:4511486-4511508 CTCTTCAGCTGTTGGTGGTTTGG - Intergenic
1004413708 6:15405259-15405281 CTTTTCATTTCTTGCTAATTTGG + Intronic
1004539362 6:16535175-16535197 CTCTTCCTTTTGTGGGAGTTTGG - Intronic
1006035486 6:31208254-31208276 CAGTTCATTTATTGGGACTTGGG - Intergenic
1014762597 6:125373634-125373656 CTCTTCTGTTTTTGGTAATTGGG - Intergenic
1015752237 6:136571978-136572000 TTCTTAATTTATTGATAGTACGG + Intronic
1016306686 6:142692473-142692495 TCCTTCATTTATTGGTAGTGCGG - Intergenic
1017030874 6:150220415-150220437 TTCTTTATTTATAGGTAGTTGGG + Intronic
1017687414 6:156927439-156927461 CTCATCATTTTTTGGGAGGTGGG + Intronic
1020839474 7:13197395-13197417 CTTTTAATTTGTTGGTTGTTTGG + Intergenic
1021038455 7:15830560-15830582 TTCATCATTTATAAGTAGTTAGG - Intergenic
1022311530 7:29200743-29200765 CTCTGCATTTGTTTGTAGCTTGG - Intronic
1024955841 7:54918553-54918575 TTCTTCATTTATAGTAAGTTTGG - Intergenic
1027553586 7:79633800-79633822 CTTCTCATTTCTTGGTAATTAGG + Intergenic
1027589826 7:80104457-80104479 CTCATCATTGATTGATAATTTGG + Intergenic
1028338194 7:89683933-89683955 CTCATCACTTTTTGGCAGTTGGG + Intergenic
1028396130 7:90370307-90370329 TTCTTCATTCATTGGTTGATGGG - Intronic
1031629173 7:124025637-124025659 CTCTTCATTCATTGCTACTAAGG + Intergenic
1034464927 7:151221689-151221711 CTCTTCACTAATTGGTTCTTTGG - Intronic
1036179469 8:6570960-6570982 CTTTTTATTTACTGGTAGCTTGG + Intronic
1039139054 8:34362322-34362344 TTCTTCATTTATTTTTAATTGGG + Intergenic
1041570008 8:59327072-59327094 CTATTCATATTTTGGCAGTTTGG - Intergenic
1042328656 8:67555283-67555305 CTCTCCCTTTCTTGGAAGTTAGG - Intronic
1043651172 8:82594416-82594438 CCCTTGATTTGTTGGTACTTGGG + Intergenic
1043685168 8:83075426-83075448 CTCTTCATTTATATTTATTTTGG - Intergenic
1044578323 8:93795530-93795552 CTATTCAGATATTGGCAGTTGGG - Intronic
1045777642 8:105824466-105824488 CTTTTCATTCTTTAGTAGTTTGG + Intergenic
1045937742 8:107701550-107701572 CTCTTCAGTTTTTAGAAGTTGGG + Intergenic
1046569425 8:115944315-115944337 TTTTTCATATATAGGTAGTTGGG + Intergenic
1046602582 8:116334311-116334333 ATCTTCATGTAATGGTAGTAAGG - Intergenic
1048476444 8:134746146-134746168 CTTTTCATTGATTGGTTGGTTGG - Intergenic
1048745320 8:137608559-137608581 CTCTTCCTTTACTGGAATTTAGG + Intergenic
1050144684 9:2554604-2554626 CTCTTCATTTTTTTCTAGTTCGG - Intergenic
1051310936 9:15771418-15771440 GTATTCTTTGATTGGTAGTTAGG + Intronic
1053874321 9:42527876-42527898 CTCTTAAGTTATTAGTACTTTGG - Intergenic
1053898294 9:42766712-42766734 CTCTTAAGTTATTAGTACTTTGG + Intergenic
1054268014 9:62938878-62938900 CTCTTAAGTTATTAGTACTTTGG + Intergenic
1055536816 9:77255589-77255611 CTCTTCAGTTTTTGATTGTTTGG + Intronic
1057860468 9:98636890-98636912 CTCTGCATTTATGGGCAATTCGG - Intronic
1058219184 9:102275440-102275462 TTATTCATTTCTTGGTGGTTAGG + Intergenic
1058951870 9:109911474-109911496 ATTTTCATTTATTTGTATTTGGG + Intronic
1185823567 X:3227593-3227615 GCCTTCATTTATTGGTAGGAGGG + Intergenic
1186809460 X:13174095-13174117 CTATTCATTTATCTGTAGTTTGG + Intergenic
1190101834 X:47527942-47527964 CTCTTCCTTTCTTGTTGGTTGGG - Intergenic
1192821542 X:74651453-74651475 TTCTTCATTTATTTTTACTTAGG + Intergenic
1194567086 X:95503139-95503161 TTATTCATTTATTTGTAGATAGG + Intergenic
1196600032 X:117590825-117590847 CTATTCAGTTATTGATACTTGGG - Intergenic
1200323988 X:155218220-155218242 CACTTCAATTATTAATAGTTTGG - Intronic
1201255850 Y:12107572-12107594 GCCTTCATTTATTGGTAGGAGGG - Intergenic