ID: 972853836

View in Genome Browser
Species Human (GRCh38)
Location 4:43082217-43082239
Sequence GGGCAAACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972853836_972853845 19 Left 972853836 4:43082217-43082239 CCGTCCACCACTGCTGTTTGCCC No data
Right 972853845 4:43082259-43082281 GACTTCCATCCCTCCAGATCTGG 0: 29
1: 69
2: 102
3: 85
4: 220
972853836_972853846 23 Left 972853836 4:43082217-43082239 CCGTCCACCACTGCTGTTTGCCC No data
Right 972853846 4:43082263-43082285 TCCATCCCTCCAGATCTGGCAGG 0: 17
1: 36
2: 91
3: 149
4: 298
972853836_972853848 24 Left 972853836 4:43082217-43082239 CCGTCCACCACTGCTGTTTGCCC No data
Right 972853848 4:43082264-43082286 CCATCCCTCCAGATCTGGCAGGG 0: 17
1: 43
2: 88
3: 172
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972853836 Original CRISPR GGGCAAACAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr