ID: 972857665

View in Genome Browser
Species Human (GRCh38)
Location 4:43126748-43126770
Sequence TTCTCTATGTATAAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972857663_972857665 -6 Left 972857663 4:43126731-43126753 CCAGTTAGAACAAGAAGTTCTCT No data
Right 972857665 4:43126748-43126770 TTCTCTATGTATAAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972857665 Original CRISPR TTCTCTATGTATAAGGAGAA TGG Intergenic
No off target data available for this crispr