ID: 972857929

View in Genome Browser
Species Human (GRCh38)
Location 4:43130557-43130579
Sequence TACCCAAGACTATTGTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972857929_972857932 8 Left 972857929 4:43130557-43130579 CCCTTTTACAATAGTCTTGGGTA No data
Right 972857932 4:43130588-43130610 CTTGCCTGTCAAACTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972857929 Original CRISPR TACCCAAGACTATTGTAAAA GGG (reversed) Intergenic
No off target data available for this crispr