ID: 972863269

View in Genome Browser
Species Human (GRCh38)
Location 4:43199014-43199036
Sequence TGATGGGGATACAACTTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972863264_972863269 11 Left 972863264 4:43198980-43199002 CCTAGCAAGTTTGAGATGTAAAT No data
Right 972863269 4:43199014-43199036 TGATGGGGATACAACTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972863269 Original CRISPR TGATGGGGATACAACTTAAA AGG Intergenic
No off target data available for this crispr