ID: 972875459

View in Genome Browser
Species Human (GRCh38)
Location 4:43353076-43353098
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972875459_972875462 26 Left 972875459 4:43353076-43353098 CCTCAGATTAACAGGAGCATGGG No data
Right 972875462 4:43353125-43353147 TTTAGTTCAAATTAATACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972875459 Original CRISPR CCCATGCTCCTGTTAATCTG AGG (reversed) Intergenic
No off target data available for this crispr