ID: 972876331

View in Genome Browser
Species Human (GRCh38)
Location 4:43365588-43365610
Sequence CACTGTCCCCAAGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972876331_972876336 5 Left 972876331 4:43365588-43365610 CCTTCTTCCTCTTGGGGACAGTG No data
Right 972876336 4:43365616-43365638 ATGTAGAGAACGCTCCATCCAGG No data
972876331_972876337 16 Left 972876331 4:43365588-43365610 CCTTCTTCCTCTTGGGGACAGTG No data
Right 972876337 4:43365627-43365649 GCTCCATCCAGGAGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972876331 Original CRISPR CACTGTCCCCAAGAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr