ID: 972878287

View in Genome Browser
Species Human (GRCh38)
Location 4:43393137-43393159
Sequence AAGGCTAGGTATTTACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972878283_972878287 18 Left 972878283 4:43393096-43393118 CCTTGTCTTTGTCTGTTTAGTGT No data
Right 972878287 4:43393137-43393159 AAGGCTAGGTATTTACAAAGAGG No data
972878282_972878287 19 Left 972878282 4:43393095-43393117 CCCTTGTCTTTGTCTGTTTAGTG No data
Right 972878287 4:43393137-43393159 AAGGCTAGGTATTTACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972878287 Original CRISPR AAGGCTAGGTATTTACAAAG AGG Intergenic
No off target data available for this crispr