ID: 972879850

View in Genome Browser
Species Human (GRCh38)
Location 4:43410046-43410068
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 19, 1: 13, 2: 11, 3: 38, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900091435 1:922473-922495 TGGCAGCCACAGCTGGGGTCAGG + Intergenic
900201217 1:1407525-1407547 TCGGAGCCACAGCTGCGGCCGGG - Intergenic
900329532 1:2127118-2127140 TTGTTGCCTCAGTGGGAGCCTGG + Intronic
900531647 1:3156742-3156764 CTGTGGCCACTGCTTGAGCCGGG - Intronic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
900827151 1:4935894-4935916 TTGCAGACACTGCTGAAGCCAGG + Intergenic
901758055 1:11453361-11453383 TTGCAGCCTGAACTGGAGCCTGG - Intergenic
902500376 1:16907135-16907157 TGGTCGCCAGAGCTGGGGCCTGG + Intronic
903163889 1:21508074-21508096 TTGGAGCCAGAACTGGGGCCTGG - Intergenic
903813173 1:26046051-26046073 CTGCAGCCGCAGCGGGAGCCGGG - Exonic
904709846 1:32421938-32421960 TGGAAGCCAGAGCTGCAGCCAGG + Intergenic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
905344324 1:37301140-37301162 TTGCAGCCACTGCTAGAACCTGG - Intergenic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905473249 1:38208362-38208384 TTGTGACCAGAGCTGGGGCCTGG + Intergenic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
909700225 1:78513834-78513856 TTTGAGCCACAGGTGGAGTCCGG - Intronic
910446353 1:87302205-87302227 TTGCTGCCACAACTGAAGCCAGG - Intergenic
911737993 1:101358417-101358439 TTTCAGCCACAGTTAGAGCCCGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913100434 1:115559118-115559140 TTGTAGCCATTGTTGGAGTCTGG - Intergenic
914306724 1:146426654-146426676 TTGAAACCACAGCAGGAGGCAGG - Intergenic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
917647796 1:177046198-177046220 TTGGAGTTACAGCTGGTGCCAGG - Intronic
918057338 1:181033366-181033388 GTGTAGCCACAGCTTGATCTTGG + Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
920332719 1:205222495-205222517 TTGTTGCCCAGGCTGGAGCCAGG + Intergenic
922730433 1:227946527-227946549 CCGTACCCACAGTTGGAGCCAGG + Intronic
1062854848 10:774841-774863 GTGCAGCCACACCTGGAGACGGG + Intergenic
1064270402 10:13860045-13860067 TTGTAGCATTTGCTGGAGCCTGG + Intronic
1064938199 10:20703916-20703938 TAGGAGCCACACCAGGAGCCAGG - Intergenic
1066139575 10:32489818-32489840 TTCAAGCCAGTGCTGGAGCCTGG + Intronic
1068986682 10:63114111-63114133 GTCTAGCCAAAGCTGAAGCCTGG + Intergenic
1070539334 10:77404972-77404994 TTTCAGGCACAGCTGGATCCGGG - Intronic
1071669706 10:87597205-87597227 TTCCAGCCCCAGCTGGAGTCAGG + Intergenic
1071879340 10:89878070-89878092 CTCTTGCCACAGCTGGACCCTGG - Intergenic
1072296037 10:94010243-94010265 TTTGAGCCACAGCTGGAACTGGG + Intronic
1075424057 10:122327929-122327951 TTTCAGCCACAGCTCCAGCCGGG + Intronic
1075511125 10:123073753-123073775 TTCTGGCCACAGCTGCAGTCTGG + Intergenic
1076419979 10:130324437-130324459 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1076761888 10:132610159-132610181 TTGGAGCCCCAGGTAGAGCCTGG - Intronic
1079058717 11:17229124-17229146 TTGTAGCCACAGCTAGAGCCTGG - Intronic
1080640524 11:34155796-34155818 CTGCAGCCCCTGCTGGAGCCTGG + Intronic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1085053498 11:73391447-73391469 TGGCAGCCACAGCTGGGGGCTGG + Intronic
1085475581 11:76786843-76786865 TTGTAGCCACACTGGGATCCTGG + Intronic
1085965032 11:81513165-81513187 TTTTAGCCACAGCTGAAGCAGGG - Intergenic
1086954836 11:92925332-92925354 TTTTAGCCATAACTGGAGCTAGG - Intergenic
1086958941 11:92962439-92962461 TGGAAGCCAGAGCTGGAACCAGG - Intergenic
1087071566 11:94086593-94086615 ATGTAGCCATAACTGCAGCCTGG + Intronic
1088270628 11:108030598-108030620 TTGTTGCCCAAGCTGGAGCGCGG - Intronic
1088442532 11:109887749-109887771 TTGTACCTACAACTGGGGCCAGG + Intergenic
1089002860 11:115066900-115066922 ATGCTGCAACAGCTGGAGCCAGG + Intergenic
1089733144 11:120532095-120532117 AGACAGCCACAGCTGGAGCCGGG + Intronic
1092487747 12:8916843-8916865 TAGTAGCCTGAGCTGGAACCAGG + Intronic
1094024050 12:25943374-25943396 GTGTGGCCCCAGCTGGAGACTGG - Intergenic
1095838849 12:46669797-46669819 TTTGAGCTGCAGCTGGAGCCAGG + Intergenic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1100199674 12:92284828-92284850 ATTTATCAACAGCTGGAGCCTGG + Intergenic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101526414 12:105535179-105535201 TTTTAGCCATAGCTGGACACAGG + Intergenic
1103982286 12:124744426-124744448 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1104002695 12:124870262-124870284 TTGTAGCCACATCTGCCACCTGG + Intronic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104703899 12:130928345-130928367 CTGCAGGCACAGCTGGATCCAGG - Intergenic
1105948104 13:25206918-25206940 ATGTAGCCACAGCTTCAACCAGG - Intergenic
1106396402 13:29385100-29385122 TTGTACCAACAACTGGAGCCTGG - Intronic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1108512581 13:51169665-51169687 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1108770950 13:53699947-53699969 TTTTAGCCATGGCTGGAGCTGGG - Intergenic
1109297542 13:60552861-60552883 TTTTAGCCATGGCTGGAGCTGGG + Intronic
1111051210 13:82884675-82884697 TTTGTGCCACAGCTGGAGCTGGG + Intergenic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117357385 14:54937980-54938002 TTCTAGCCACATCTGGAACTCGG - Intergenic
1117357967 14:54944440-54944462 TTCTAACCACATCTGGAACCCGG + Exonic
1118246206 14:64113468-64113490 TTGCAGCCACAGCTCCAGCTCGG - Exonic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1118752663 14:68817977-68817999 TTGGAGAAACAGCTGGATCCTGG - Intergenic
1119140448 14:72262817-72262839 TGTCAGCCACAGCTGGATCCAGG + Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119559696 14:75580116-75580138 TTTTACACACAGCTGAAGCCAGG + Intronic
1120199116 14:81517500-81517522 TTGTAGCAAGAGCAGCAGCCAGG - Intronic
1121294700 14:92809394-92809416 TTGCAGCCACAGCTTCAGTCAGG - Exonic
1121310102 14:92931322-92931344 GTGAAGCCACAGACGGAGCCAGG + Exonic
1121484849 14:94306610-94306632 TTAGTGGCACAGCTGGAGCCAGG - Intronic
1121904118 14:97724060-97724082 ATGTAGCCACAGCTCGAGGAAGG - Intergenic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1123754832 15:23389026-23389048 TGGTAGCCAGATCTGGAGGCAGG + Intergenic
1123876744 15:24630967-24630989 TTCCAGCCACAGCAGGTGCCAGG + Intergenic
1125492113 15:40155924-40155946 CTATAGCCCCAGCAGGAGCCTGG - Intergenic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1129251543 15:74311898-74311920 TGGCGGCCACAGCTGGACCCTGG - Intronic
1129276365 15:74448352-74448374 TTCTAGGAACAGCTGGAGCATGG - Intronic
1129322823 15:74784037-74784059 TTGTGGCCACAGCAGGAACAGGG + Intronic
1129452835 15:75660239-75660261 TTGTGGCCACAGATGGGGGCTGG + Exonic
1131063167 15:89416872-89416894 TTGTACGCACACCTGCAGCCCGG - Intergenic
1131541580 15:93279541-93279563 CAGGAGCCAAAGCTGGAGCCTGG + Intergenic
1131889646 15:96958819-96958841 TTGTAGCTGGAGCTGGAGCCAGG + Intergenic
1132256996 15:100384525-100384547 TTGCTGTCACAGCTGGGGCCTGG - Intergenic
1132678289 16:1129681-1129703 TTGTGGACTCAGCCGGAGCCTGG - Intergenic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1132953650 16:2579178-2579200 TAGTTGTCACAGCTGGAGCAGGG + Intronic
1132960701 16:2620989-2621011 TAGTTGTCACAGCTGGAGCAGGG - Intergenic
1134108418 16:11499727-11499749 GTGAAGACACAGCTGGTGCCAGG - Intronic
1134461540 16:14433954-14433976 TGGTAGCCAGATCTGGAGGCAGG - Intergenic
1135048654 16:19174431-19174453 CAGGACCCACAGCTGGAGCCTGG + Intronic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136141655 16:28292593-28292615 CTGGAGCCGCAGCCGGAGCCCGG + Exonic
1137382445 16:48011858-48011880 TAGGAGCCACAGCAGGAGACAGG + Intergenic
1137451329 16:48577529-48577551 TTGCAGCCACAGCTGCAGCCTGG + Intronic
1137547046 16:49411573-49411595 TTGTTTCTACAGCTGGGGCCAGG - Intergenic
1138229833 16:55328799-55328821 TAGTGGCCACAGCTGGGGACAGG + Exonic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139160283 16:64497860-64497882 TAGTAGACAGAGCAGGAGCCTGG + Intergenic
1139550032 16:67667830-67667852 TGGGAGCCAGGGCTGGAGCCTGG + Intronic
1139657748 16:68399284-68399306 TTGAACCCAGAGCAGGAGCCAGG - Intronic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1143796748 17:9343069-9343091 TGGTAAGGACAGCTGGAGCCAGG + Intronic
1144632025 17:16878710-16878732 CAGTGGCCACAGCTGCAGCCTGG + Intergenic
1146168056 17:30607213-30607235 TTTTAGGCACAGCTAGATCCCGG + Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146313180 17:31786663-31786685 TTGTGTCCACAGCTTGACCCTGG - Intergenic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1148467371 17:47872987-47873009 GTGTGGCCACAGCTGGAGAAGGG - Intergenic
1148961563 17:51397567-51397589 TTGGGGCCAGAGTTGGAGCCAGG + Intergenic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1151348202 17:73516201-73516223 TGGTAGAGACAGCTGGAGCCTGG + Intronic
1151715222 17:75827738-75827760 TTGCAGCCAGGGCTGGAGGCAGG + Exonic
1152388322 17:79988349-79988371 AATCAGCCACAGCTGGAGCCAGG - Intronic
1152896531 17:82914470-82914492 GTGCAGACACAGCTGGAGGCCGG - Intronic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1153864009 18:9245421-9245443 CTGTAGCCCCAGCTGGAGAGTGG - Intronic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1157222882 18:45839910-45839932 TTGTGGCCACAGCAGCAGCCAGG - Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160078681 18:75702914-75702936 TTGTATCCTCACCTGGAGCTGGG + Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1160849953 19:1185871-1185893 TTTCAGACACAGCTGGATCCAGG + Intronic
1160926989 19:1551259-1551281 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1161455349 19:4367081-4367103 TCGCATCCACAGCTGGAGGCAGG + Intronic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1161960526 19:7520602-7520624 TTGCGGCCAGAGCTGGTGCCAGG - Exonic
1162244209 19:9385745-9385767 GTGTAGCAACAGCTGGTGCTGGG + Intergenic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1165509649 19:36258600-36258622 ATGTAGCCACAGCTCGACACAGG + Intergenic
1165511715 19:36270087-36270109 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165512264 19:36272588-36272610 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165512811 19:36275129-36275151 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165513367 19:36277684-36277706 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165513916 19:36280218-36280240 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165514469 19:36282755-36282777 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165515020 19:36285288-36285310 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165515571 19:36287824-36287846 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165516122 19:36290361-36290383 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165516672 19:36292887-36292909 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165517225 19:36295410-36295432 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165517777 19:36297945-36297967 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165518330 19:36300480-36300502 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165518880 19:36303012-36303034 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165519429 19:36305527-36305549 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165519977 19:36308055-36308077 ATGTAGCCACAGCTCGACGCAGG + Intergenic
1165624090 19:37270526-37270548 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165624636 19:37273067-37273089 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165625179 19:37275594-37275616 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165625713 19:37278132-37278154 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165626254 19:37280660-37280682 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165626792 19:37283187-37283209 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165627334 19:37285705-37285727 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165627875 19:37288233-37288255 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165628412 19:37290757-37290779 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165628949 19:37293285-37293307 ATGTAGCCACAGCTAGACGCAGG - Intergenic
1165629495 19:37295808-37295830 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165630036 19:37298333-37298355 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165630579 19:37300861-37300883 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165631113 19:37303402-37303424 ATGTAGCCACAGCTCGACGCAGG - Intergenic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1166313814 19:41977752-41977774 TTGCAGCCACAGAGGTAGCCAGG - Intronic
1166865692 19:45835430-45835452 TGTGAGCCACAGCAGGAGCCAGG + Intronic
1167215552 19:48162093-48162115 CTGCAGGCACAGCTGGATCCAGG - Intronic
926130765 2:10302356-10302378 AGGTAACCAGAGCTGGAGCCAGG + Intergenic
926233752 2:11024030-11024052 TGGTAGTGACAGCTGGAGGCAGG - Intergenic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928914908 2:36460134-36460156 ATGTAACCACAGCTGCAGCCAGG - Intronic
931828302 2:66024544-66024566 TGTTAGCCACAGCTGGCACCAGG + Intergenic
933184108 2:79259734-79259756 TTTTAACCACAGCTGCAGTCAGG + Intronic
933659636 2:84916638-84916660 TTGTAGCCACATCTGAAGCCTGG - Intergenic
933974976 2:87502115-87502137 AAGTAGCCACAGCAGTAGCCTGG - Intergenic
934714468 2:96535647-96535669 TTGGAGCCAGAGCTAGACCCAGG - Intergenic
936024232 2:109019092-109019114 TTGTAGCCACAGAGGAGGCCCGG + Intergenic
936318850 2:111448698-111448720 AAGTAGCCACAGCAGTAGCCTGG + Intergenic
936574773 2:113643943-113643965 TTGTGGTCTCAGCTGGAGGCCGG + Intergenic
937465323 2:122127326-122127348 TTTTAGCCACAGCTGAAACTGGG - Intergenic
939796292 2:146648135-146648157 TTGAAGCCACAGATGGATTCGGG - Intergenic
940560159 2:155284849-155284871 TTGTATCCATTCCTGGAGCCTGG + Intergenic
941319680 2:164039435-164039457 TTTTAGCCATGGCTGGATCCAGG - Intergenic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
942195958 2:173520330-173520352 GTGTAGCCTCAGAAGGAGCCAGG + Intergenic
944644388 2:201763549-201763571 TTGTAGCCACAGCTAGAGCCTGG - Intronic
946488022 2:220119663-220119685 TTGTTGTCACAGCTGGAGACAGG + Intergenic
946608463 2:221432367-221432389 TTGTAGCCACATTTGGATTCAGG - Intronic
946707873 2:222476383-222476405 TTGAAGTCCCAGGTGGAGCCAGG - Intronic
948252193 2:236538414-236538436 CTGTGGCCACAGCGGAAGCCAGG + Intergenic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
948772125 2:240256997-240257019 TTTCAGGCACAGCTGGATCCAGG + Intergenic
1170540094 20:17379035-17379057 TTTGAACCACAGCTGTAGCCAGG - Intronic
1171963048 20:31509071-31509093 TTGCAGCCCCTGCTGGAGCCTGG - Intergenic
1172208404 20:33180938-33180960 TTGAGGCCACTACTGGAGCCAGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1175099468 20:56568187-56568209 TTGTATCCACGGGTGGATCCTGG + Intergenic
1175124860 20:56743554-56743576 TGGTTGTCACAGCTGGGGCCTGG - Intergenic
1175304187 20:57964798-57964820 CTGCAGGCACAGCTGGATCCAGG + Intergenic
1175748888 20:61481202-61481224 TTATTGCCACAGCTGGGGCGTGG + Intronic
1176093273 20:63328387-63328409 TTGGAGCAGAAGCTGGAGCCGGG + Exonic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1179034710 21:37749500-37749522 TTGCACCCATACCTGGAGCCCGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181110394 22:20599300-20599322 TTCCAGCCACAGCAGGAGGCTGG - Intergenic
1181544233 22:23592014-23592036 GCGTAGCCACAGAAGGAGCCTGG - Intergenic
1181981375 22:26769232-26769254 TTGTACCCACAGCCAGAGCCGGG + Intergenic
1182158599 22:28099408-28099430 TTGTGCCCACAGCTCGTGCCTGG + Intronic
1184630801 22:45777269-45777291 TTGTTACCATAGCTGGAGTCGGG + Intronic
1184757271 22:46524144-46524166 TTGTAGCGACAGGAAGAGCCAGG - Intronic
1185425400 22:50766933-50766955 TTGTGGTCTCAGCTGGAGGCCGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
954108956 3:48423762-48423784 ACGTGGCCACAGCTGCAGCCTGG + Exonic
954317672 3:49810129-49810151 CTGAAGCCACTGCTGGAGGCAGG - Exonic
954759983 3:52867019-52867041 TGGTAGCCAGGGCTGCAGCCGGG - Intronic
954796711 3:53165162-53165184 TTGTAGCAGCAGCGGGAGCCAGG + Intronic
954914851 3:54139978-54140000 TTTAAGCCACTGGTGGAGCCAGG - Intronic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
961054183 3:123773980-123774002 TGGCAGCCTCAGCTGGAGACAGG - Intronic
961185679 3:124913065-124913087 GTCTTGCCACAGCTGGAGCTAGG - Intronic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961507088 3:127377269-127377291 TTGCAGCCCCAGCTCCAGCCTGG - Intergenic
963606210 3:147413390-147413412 TCGTAGCCAGAGCTGGCGGCCGG - Exonic
963640731 3:147858494-147858516 TTTGAGCCGCAGCTGGAGCTGGG + Intergenic
964523714 3:157594846-157594868 TTGTAACCACAGTTGGAGGCAGG + Intronic
966177171 3:177151353-177151375 TGGTGCCCACAGCTGCAGCCGGG - Intronic
966324951 3:178743515-178743537 TTGTCAACACAGCAGGAGCCTGG - Intronic
966914147 3:184575665-184575687 TTGTAGCTGCAGCTGGAGTTAGG + Intronic
968962113 4:3750918-3750940 ATCCAGTCACAGCTGGAGCCAGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970886368 4:20991788-20991810 TTGTAGCCATGGCTGGGGCTTGG + Intronic
971042324 4:22767491-22767513 TTGTAGGCACAGCTGTTGTCTGG + Intergenic
972548257 4:40102993-40103015 TTGTAACCACAGCTGCACACTGG + Exonic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973296100 4:48522317-48522339 GTGTAACCATAGCTGGTGCCTGG + Intronic
973317976 4:48780794-48780816 ATGTATCCAGAGCTGGCGCCCGG + Intergenic
975344810 4:73281782-73281804 CTGTAGCCAGAGCTTGAGCAGGG - Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
979106318 4:116692942-116692964 TTGTAGCCACTGCTGAGGCATGG + Intergenic
981337814 4:143586613-143586635 TTCTACCCACCGCTGAAGCCTGG - Intronic
982053921 4:151528834-151528856 TTGTAGCCTCAGCTGAAGGGGGG - Intronic
982863370 4:160481859-160481881 TTGGAGCCCCAGCTGGCTCCAGG + Intergenic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
983736671 4:171070471-171070493 TTTTAGCTACAGCTGGGGCTGGG + Intergenic
983989576 4:174101347-174101369 TGGGAGCCAGAGCTAGAGCCTGG - Intergenic
984131288 4:175878555-175878577 TTTTAGCCACAGCTGGGACAGGG + Intronic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
986582313 5:9278698-9278720 CTTTAGCCATAGCTGGAGCTGGG - Intronic
987546595 5:19318208-19318230 TTGTAGCTACAGCTGCAGATAGG - Intergenic
987675025 5:21063399-21063421 TTTTAGCCATAGCCGGAGCTGGG - Intergenic
988265938 5:28951228-28951250 TTATAGCCACAGTGGAAGCCTGG - Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
997737923 5:136228162-136228184 TTGTACCCAGAGCTGGAGGAGGG + Intronic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
999348388 5:150844483-150844505 TAGCAGCCACAGATGAAGCCTGG + Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1002105531 5:176877827-176877849 TTGAAGCCACAGCTGGCCCTAGG + Intronic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1005488320 6:26322444-26322466 CTGTAGCCCCGGCTGGAGTCTGG + Intergenic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1010204079 6:73307709-73307731 TTTTAGCCAGAGCACGAGCCAGG - Intronic
1012252592 6:96995517-96995539 GTGAAGCCACTCCTGGAGCCTGG - Intronic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1013271073 6:108545766-108545788 TTGAACCCACAGCTGGATGCAGG + Intergenic
1015081332 6:129228789-129228811 TTAGAGCCACAGCTGGAGAAAGG - Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017638669 6:156468560-156468582 TTGTGTCCACAGATGGGGCCTGG - Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019758361 7:2789816-2789838 TTGCAGCCACAGAGGAAGCCAGG + Intronic
1020264917 7:6553871-6553893 TTTCAGGCACAGCTGGATCCAGG - Intergenic
1020586637 7:10078485-10078507 GGGTAGCCACAGCTGTAGCTGGG - Intergenic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022504320 7:30901007-30901029 TTTTAGCCACGGCAGGAGCAGGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1026374785 7:69739413-69739435 GTGTACCCACATCAGGAGCCTGG - Intronic
1026849438 7:73715913-73715935 GTGTACACACAGCTGGAGGCTGG - Intronic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1028299522 7:89180534-89180556 TTCTAGACACACCTTGAGCCAGG - Intronic
1029116768 7:98241579-98241601 TTGGAGCCTCCCCTGGAGCCGGG - Intronic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030957756 7:115876552-115876574 ATGCAGTCACTGCTGGAGCCTGG - Intergenic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032085056 7:128879510-128879532 CTGGAGCCGCACCTGGAGCCCGG + Exonic
1032330982 7:130979226-130979248 TTGAAGCCACAGCAGGGGCAAGG + Intergenic
1032488565 7:132306701-132306723 GAGTTGCCACAGCTGGAACCAGG + Intronic
1034502027 7:151456837-151456859 TTTGAGCCAAAGCTGGAGCTGGG + Intergenic
1035064687 7:156096082-156096104 TTGAAGCCACTTCTGGGGCCTGG + Intergenic
1035451407 7:158979489-158979511 TTGTAGCCACCGTCAGAGCCAGG + Intergenic
1036137611 8:6176160-6176182 TTGCAGCCTCTGCTGGAGCCGGG - Intergenic
1036598209 8:10233186-10233208 TTGTAGCCACTGCTGCAGCAGGG + Intronic
1036920214 8:12845482-12845504 TGGTAGCCACAGCTGGAGCCTGG + Intergenic
1041532372 8:58884060-58884082 TTGAAGCCTCAGCTGGACCCTGG - Intronic
1043335853 8:79175928-79175950 TTGGAGACTCAGCTGGAACCTGG + Intergenic
1043380270 8:79695123-79695145 TTGCAGCCCGAGCTGCAGCCTGG - Intergenic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1044847179 8:96393307-96393329 TATTAGCCAAAGCTGGAGGCTGG - Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1045074264 8:98545302-98545324 TTGGTGACACAGCTGAAGCCTGG + Intronic
1045402482 8:101833015-101833037 TTTCAGCCACACCCGGAGCCTGG + Intronic
1047903304 8:129446853-129446875 TTCTAGACATAGCTGGATCCAGG + Intergenic
1049832707 8:144712642-144712664 TGATATCCACAGCAGGAGCCCGG - Intergenic
1050210938 9:3255417-3255439 GTGTAGCCACAGCTACAGTCAGG + Intronic
1050935170 9:11386959-11386981 TTTGAGCCACAGCTGGAACTGGG - Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056571014 9:87814673-87814695 TGGCAGCCACAGCTGGAGTGAGG - Intergenic
1186199212 X:7139393-7139415 TGGGAGCCACAGCTGGAAACTGG - Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1194346254 X:92770947-92770969 TGGAAGCCACACCTTGAGCCTGG - Intergenic
1197955697 X:131945158-131945180 TTACAGCCACAGCTGGATTCAGG - Intergenic
1199357155 X:146875689-146875711 TTTTAGCCATGGCTTGAGCCTGG - Intergenic
1200654593 Y:5887596-5887618 TGGAAGCCACACCTTGAGCCTGG - Intergenic