ID: 972883437

View in Genome Browser
Species Human (GRCh38)
Location 4:43454948-43454970
Sequence ACCCTCTCCCTGCCAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972883431_972883437 -8 Left 972883431 4:43454933-43454955 CCCTTTCCCTATCCCACCCTCTC No data
Right 972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG No data
972883429_972883437 28 Left 972883429 4:43454897-43454919 CCAGTCTGAGACTCTATATCCTT No data
Right 972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG No data
972883430_972883437 9 Left 972883430 4:43454916-43454938 CCTTTGATCAACATCTTCCCTTT No data
Right 972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG No data
972883432_972883437 -9 Left 972883432 4:43454934-43454956 CCTTTCCCTATCCCACCCTCTCC No data
Right 972883437 4:43454948-43454970 ACCCTCTCCCTGCCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972883437 Original CRISPR ACCCTCTCCCTGCCAGCCTC TGG Intergenic
No off target data available for this crispr