ID: 972891475

View in Genome Browser
Species Human (GRCh38)
Location 4:43561416-43561438
Sequence CAGGCAGGTTACCTGAAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972891468_972891475 0 Left 972891468 4:43561393-43561415 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 972891475 4:43561416-43561438 CAGGCAGGTTACCTGAAGTCGGG No data
972891470_972891475 -1 Left 972891470 4:43561394-43561416 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 972891475 4:43561416-43561438 CAGGCAGGTTACCTGAAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972891475 Original CRISPR CAGGCAGGTTACCTGAAGTC GGG Intergenic
No off target data available for this crispr