ID: 972892269

View in Genome Browser
Species Human (GRCh38)
Location 4:43573434-43573456
Sequence TCGCAAAGTGCCAGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972892269_972892274 8 Left 972892269 4:43573434-43573456 CCTGTAATCCTGGCACTTTGCGA No data
Right 972892274 4:43573465-43573487 TTGTAGGATTGCTCGAGCCCAGG No data
972892269_972892272 -8 Left 972892269 4:43573434-43573456 CCTGTAATCCTGGCACTTTGCGA No data
Right 972892272 4:43573449-43573471 CTTTGCGAGGCCAACATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972892269 Original CRISPR TCGCAAAGTGCCAGGATTAC AGG (reversed) Intergenic
No off target data available for this crispr