ID: 972892272

View in Genome Browser
Species Human (GRCh38)
Location 4:43573449-43573471
Sequence CTTTGCGAGGCCAACATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972892269_972892272 -8 Left 972892269 4:43573434-43573456 CCTGTAATCCTGGCACTTTGCGA No data
Right 972892272 4:43573449-43573471 CTTTGCGAGGCCAACATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972892272 Original CRISPR CTTTGCGAGGCCAACATTGT AGG Intergenic
No off target data available for this crispr