ID: 972892273

View in Genome Browser
Species Human (GRCh38)
Location 4:43573459-43573481
Sequence CTCGAGCAATCCTACAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972892273_972892280 26 Left 972892273 4:43573459-43573481 CCAACATTGTAGGATTGCTCGAG No data
Right 972892280 4:43573508-43573530 CGAGATCAGCCTAGGCAATGTGG No data
972892273_972892279 18 Left 972892273 4:43573459-43573481 CCAACATTGTAGGATTGCTCGAG No data
Right 972892279 4:43573500-43573522 CAGAAGTTCGAGATCAGCCTAGG 0: 32
1: 1455
2: 17669
3: 64061
4: 66376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972892273 Original CRISPR CTCGAGCAATCCTACAATGT TGG (reversed) Intergenic
No off target data available for this crispr