ID: 972892321

View in Genome Browser
Species Human (GRCh38)
Location 4:43574161-43574183
Sequence ACAGGCTCTGCTTGCACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972892321_972892327 21 Left 972892321 4:43574161-43574183 CCTTGAGTGCAAGCAGAGCCTGT No data
Right 972892327 4:43574205-43574227 ACTGATTATATTGCAATATATGG No data
972892321_972892328 28 Left 972892321 4:43574161-43574183 CCTTGAGTGCAAGCAGAGCCTGT No data
Right 972892328 4:43574212-43574234 ATATTGCAATATATGGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972892321 Original CRISPR ACAGGCTCTGCTTGCACTCA AGG (reversed) Intergenic