ID: 972896022

View in Genome Browser
Species Human (GRCh38)
Location 4:43620928-43620950
Sequence CAAAATGCTGATAGTAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972896022_972896025 4 Left 972896022 4:43620928-43620950 CCCATATTACTATCAGCATTTTG No data
Right 972896025 4:43620955-43620977 AAACCATTCAACAAGTCTGTAGG 0: 7
1: 404
2: 2082
3: 2004
4: 1293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972896022 Original CRISPR CAAAATGCTGATAGTAATAT GGG (reversed) Intergenic
No off target data available for this crispr