ID: 972904972

View in Genome Browser
Species Human (GRCh38)
Location 4:43734565-43734587
Sequence AAGAGTATACAAATTGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972904969_972904972 11 Left 972904969 4:43734531-43734553 CCTAGCTAGTGCAATTAGACAAT No data
Right 972904972 4:43734565-43734587 AAGAGTATACAAATTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972904972 Original CRISPR AAGAGTATACAAATTGAAAA GGG Intergenic
No off target data available for this crispr