ID: 972910505

View in Genome Browser
Species Human (GRCh38)
Location 4:43810570-43810592
Sequence TTTTCTTTTTTTTTTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379163
Summary {0: 1386, 1: 87388, 2: 68022, 3: 80236, 4: 142131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972910505_972910506 19 Left 972910505 4:43810570-43810592 CCATCTCAAAAAAAAAAAGAAAA 0: 1386
1: 87388
2: 68022
3: 80236
4: 142131
Right 972910506 4:43810612-43810634 AATTGACCCACAGCTCCACATGG 0: 2
1: 90
2: 2112
3: 4797
4: 8316
972910505_972910508 24 Left 972910505 4:43810570-43810592 CCATCTCAAAAAAAAAAAGAAAA 0: 1386
1: 87388
2: 68022
3: 80236
4: 142131
Right 972910508 4:43810617-43810639 ACCCACAGCTCCACATGGCTGGG No data
972910505_972910510 25 Left 972910505 4:43810570-43810592 CCATCTCAAAAAAAAAAAGAAAA 0: 1386
1: 87388
2: 68022
3: 80236
4: 142131
Right 972910510 4:43810618-43810640 CCCACAGCTCCACATGGCTGGGG No data
972910505_972910507 23 Left 972910505 4:43810570-43810592 CCATCTCAAAAAAAAAAAGAAAA 0: 1386
1: 87388
2: 68022
3: 80236
4: 142131
Right 972910507 4:43810616-43810638 GACCCACAGCTCCACATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972910505 Original CRISPR TTTTCTTTTTTTTTTTGAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr