ID: 972910507

View in Genome Browser
Species Human (GRCh38)
Location 4:43810616-43810638
Sequence GACCCACAGCTCCACATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972910505_972910507 23 Left 972910505 4:43810570-43810592 CCATCTCAAAAAAAAAAAGAAAA 0: 1386
1: 87388
2: 68022
3: 80236
4: 142131
Right 972910507 4:43810616-43810638 GACCCACAGCTCCACATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972910507 Original CRISPR GACCCACAGCTCCACATGGC TGG Intergenic
No off target data available for this crispr