ID: 972917628

View in Genome Browser
Species Human (GRCh38)
Location 4:43901005-43901027
Sequence GTTGGCTTTCTAAGAATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972917628_972917632 29 Left 972917628 4:43901005-43901027 CCTGTGATTCTTAGAAAGCCAAC No data
Right 972917632 4:43901057-43901079 TTCATTAGGTGTTCAATCCAAGG No data
972917628_972917631 15 Left 972917628 4:43901005-43901027 CCTGTGATTCTTAGAAAGCCAAC No data
Right 972917631 4:43901043-43901065 TTATTTGCTACTACTTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972917628 Original CRISPR GTTGGCTTTCTAAGAATCAC AGG (reversed) Intergenic
No off target data available for this crispr