ID: 972917632

View in Genome Browser
Species Human (GRCh38)
Location 4:43901057-43901079
Sequence TTCATTAGGTGTTCAATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972917630_972917632 11 Left 972917630 4:43901023-43901045 CCAACTCTCAGGCAAATATTTTA No data
Right 972917632 4:43901057-43901079 TTCATTAGGTGTTCAATCCAAGG No data
972917628_972917632 29 Left 972917628 4:43901005-43901027 CCTGTGATTCTTAGAAAGCCAAC No data
Right 972917632 4:43901057-43901079 TTCATTAGGTGTTCAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972917632 Original CRISPR TTCATTAGGTGTTCAATCCA AGG Intergenic
No off target data available for this crispr