ID: 972918157

View in Genome Browser
Species Human (GRCh38)
Location 4:43905323-43905345
Sequence AACCCTACATTGTCGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918157_972918161 6 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918161 4:43905352-43905374 GCCCTCCTGTTTGTTGTCTCAGG No data
972918157_972918167 19 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918167 4:43905365-43905387 TTGTCTCAGGGAAGGCTGCAAGG No data
972918157_972918168 20 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data
972918157_972918169 21 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data
972918157_972918163 7 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918163 4:43905353-43905375 CCCTCCTGTTTGTTGTCTCAGGG No data
972918157_972918166 11 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918166 4:43905357-43905379 CCTGTTTGTTGTCTCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918157 Original CRISPR AACCCTACATTGTCGGCAAA GGG (reversed) Intergenic
No off target data available for this crispr