ID: 972918158

View in Genome Browser
Species Human (GRCh38)
Location 4:43905324-43905346
Sequence CAACCCTACATTGTCGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918158_972918169 20 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data
972918158_972918166 10 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918166 4:43905357-43905379 CCTGTTTGTTGTCTCAGGGAAGG No data
972918158_972918167 18 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918167 4:43905365-43905387 TTGTCTCAGGGAAGGCTGCAAGG No data
972918158_972918161 5 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918161 4:43905352-43905374 GCCCTCCTGTTTGTTGTCTCAGG No data
972918158_972918168 19 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data
972918158_972918163 6 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918163 4:43905353-43905375 CCCTCCTGTTTGTTGTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918158 Original CRISPR CAACCCTACATTGTCGGCAA AGG (reversed) Intergenic
No off target data available for this crispr