ID: 972918159

View in Genome Browser
Species Human (GRCh38)
Location 4:43905330-43905352
Sequence CTGGATCAACCCTACATTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918159_972918169 14 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data
972918159_972918163 0 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918163 4:43905353-43905375 CCCTCCTGTTTGTTGTCTCAGGG No data
972918159_972918168 13 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data
972918159_972918166 4 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918166 4:43905357-43905379 CCTGTTTGTTGTCTCAGGGAAGG No data
972918159_972918167 12 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918167 4:43905365-43905387 TTGTCTCAGGGAAGGCTGCAAGG No data
972918159_972918161 -1 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918161 4:43905352-43905374 GCCCTCCTGTTTGTTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918159 Original CRISPR CTGGATCAACCCTACATTGT CGG (reversed) Intergenic
No off target data available for this crispr