ID: 972918160

View in Genome Browser
Species Human (GRCh38)
Location 4:43905349-43905371
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918160_972918172 30 Left 972918160 4:43905349-43905371 CCAGCCCTCCTGTTTGTTGTCTC No data
Right 972918172 4:43905402-43905424 ATTAAAGATACAAATCCCAGAGG No data
972918160_972918167 -7 Left 972918160 4:43905349-43905371 CCAGCCCTCCTGTTTGTTGTCTC No data
Right 972918167 4:43905365-43905387 TTGTCTCAGGGAAGGCTGCAAGG No data
972918160_972918168 -6 Left 972918160 4:43905349-43905371 CCAGCCCTCCTGTTTGTTGTCTC No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data
972918160_972918169 -5 Left 972918160 4:43905349-43905371 CCAGCCCTCCTGTTTGTTGTCTC No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918160 Original CRISPR GAGACAACAAACAGGAGGGC TGG (reversed) Intergenic
No off target data available for this crispr