ID: 972918167

View in Genome Browser
Species Human (GRCh38)
Location 4:43905365-43905387
Sequence TTGTCTCAGGGAAGGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918160_972918167 -7 Left 972918160 4:43905349-43905371 CCAGCCCTCCTGTTTGTTGTCTC No data
Right 972918167 4:43905365-43905387 TTGTCTCAGGGAAGGCTGCAAGG No data
972918158_972918167 18 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918167 4:43905365-43905387 TTGTCTCAGGGAAGGCTGCAAGG No data
972918159_972918167 12 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918167 4:43905365-43905387 TTGTCTCAGGGAAGGCTGCAAGG No data
972918157_972918167 19 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918167 4:43905365-43905387 TTGTCTCAGGGAAGGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918167 Original CRISPR TTGTCTCAGGGAAGGCTGCA AGG Intergenic
No off target data available for this crispr