ID: 972918168

View in Genome Browser
Species Human (GRCh38)
Location 4:43905366-43905388
Sequence TGTCTCAGGGAAGGCTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918162_972918168 -10 Left 972918162 4:43905353-43905375 CCCTCCTGTTTGTTGTCTCAGGG No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data
972918158_972918168 19 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data
972918157_972918168 20 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data
972918159_972918168 13 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data
972918160_972918168 -6 Left 972918160 4:43905349-43905371 CCAGCCCTCCTGTTTGTTGTCTC No data
Right 972918168 4:43905366-43905388 TGTCTCAGGGAAGGCTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918168 Original CRISPR TGTCTCAGGGAAGGCTGCAA GGG Intergenic
No off target data available for this crispr