ID: 972918169

View in Genome Browser
Species Human (GRCh38)
Location 4:43905367-43905389
Sequence GTCTCAGGGAAGGCTGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918159_972918169 14 Left 972918159 4:43905330-43905352 CCGACAATGTAGGGTTGATCCAG No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data
972918160_972918169 -5 Left 972918160 4:43905349-43905371 CCAGCCCTCCTGTTTGTTGTCTC No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data
972918158_972918169 20 Left 972918158 4:43905324-43905346 CCTTTGCCGACAATGTAGGGTTG No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data
972918164_972918169 -10 Left 972918164 4:43905354-43905376 CCTCCTGTTTGTTGTCTCAGGGA No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data
972918162_972918169 -9 Left 972918162 4:43905353-43905375 CCCTCCTGTTTGTTGTCTCAGGG No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data
972918157_972918169 21 Left 972918157 4:43905323-43905345 CCCTTTGCCGACAATGTAGGGTT No data
Right 972918169 4:43905367-43905389 GTCTCAGGGAAGGCTGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918169 Original CRISPR GTCTCAGGGAAGGCTGCAAG GGG Intergenic
No off target data available for this crispr