ID: 972918759

View in Genome Browser
Species Human (GRCh38)
Location 4:43911127-43911149
Sequence GGCCAGTGATCTAGGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972918759_972918765 14 Left 972918759 4:43911127-43911149 CCCCCACACCTAGATCACTGGCC No data
Right 972918765 4:43911164-43911186 TACTCAGATTAACTTCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972918759 Original CRISPR GGCCAGTGATCTAGGTGTGG GGG (reversed) Intergenic
No off target data available for this crispr